EKSPRESI GEN PENYANDI PATHOGENESIS RELATED
PROTEIN (PR1&PBZ1) PADA PADI INDICA YANG
TERLIBAT DALAM SISTEM TOLERANSI TERHADAP
PENYAKIT BLAS ISOLAT 001
LAELA SARI
SEKOLAH PASCASARJANA
INSTITUT PERTANIAN BOGOR
BOGOR
2008
PERNYATAAN MENGENAI TESIS DAN SUMBER
INFORMASI
Dengan ini saya menyatakan bahwa tesis Ekspresi Gen Penyandi
Pathogenesis Related Protein (PR1& PBZ1) pada Padi Indica yang Terlibat
Dalam Sistem Toleransi Terhadap Penyakit Blas Isolat 001 adalah karya saya
dengan arahan dari Komisi Pembimbing dan belum diajukan dalam bentuk
apapun kepada perguruan tinggi manapun. Sumber informasi yang berasal atau
dikutip dari karya yang diterbitkan maupun tidak diterbitkan dari penulis lain telah
disebutkan dalam teks dan dicantumkan dalam Daftar Pustaka di bagian akhir
tesis ini.
Bogor, Februari 2008
Laela Sari
NRP P055040061
RINGKASAN
LAELA SARI. Ekspresi Gen Penyandi Pathogenesis Related Protein
(PR1&PBZ1) pada Padi Indica yang Terlibat Dalam Sistem Toleransi
terhadap Penyakit Blas Isolat 001. Dibimbing oleh UTUT WIDYASTUTI
SUHARSONO dan SUHARSONO.
Penyakit blas yang disebabkan oleh patogen Pyricularia grisea adalah salah
satu penyakit penting yang mempengaruhi produksi padi. Gen penyandi
Pathogenesis Related protein (PR1 dan PBZ1) diketahui terlibat dalam sistem
pertahanan tanaman terhadap cekaman penyakit blas. Penelitian ini bertujuan
untuk mempelajari ekspresi gen penyandi pathogenesis related protein (PR1 dan
PBZ1) dari tanaman padi indica varietas tahan dan peka yang telah diinfeksi
dengan patogen P. grisea isolat 001. Penelitian ini diharapkan memberi informasi
mengenai mekanisme sistem pertahanan tanaman padi terhadap penyakit blas
sehingga bisa di gunakan sebagai landasan untuk merakit tanaman tahan blas.
Penelitian ini dilakukan dalam dua tahap yaitu: Tahap I adalah penapisan
ketahanan berbagai varietas padi indica terhadap Pyricularia grisea isolat 001.
Tahap II adalah analisis ekspresi gen PBZ1 dan gen PR1.
Penapisan pada penelitian ini menggunakan dua isolat yaitu isolat 001M
(Muara) dan 001B (BB-Biogen), dengan tetapi hanya 001M yang digunakan
untuk penelitian selanjutnya dikarenakan isolat 001M menghasilkan skala
penyakit blas menurut standar IRRI yang lebih konsisten/seragam terhadap kelima
varietas. Penapisan dilakukan terhadap 5 varietas tanaman padi (Asahan, IR64,
Cisadane, Cisanggang dan Kencana Bali). Penapisan dilakukan dengan cara
menyuntikkan 1 ml inokulum isolat 001M (3x105 sel/ml) yang diberi tween 20
dengan konsentrasi 0,25% dan 1 ml air yang diberi tween 20 dengan konsentrasi
0,25 % untuk tanaman kontrol. Perlakuan diulang sebanyak 3 kali. Isolasi RNA
total diisolasi dari tanaman tahan dan peka pada umur 0, 1, 3 dan 7 hari setelah
infeksi. Sintesis cDNA dilakukan dengan menggunakan enzim transkriptase balik
Superscript III. Analisis ekspresi untuk gen PR1 dan PBZ1 dilakukan dengan
menggunakan metode PCR.
Hasil penapisan dengan isolat 001M diperoleh 2 varietas tahan (R) yaitu
Cisadane dan Asahan, 1 varietas moderat tahan (MR) yaitu IR64, 2 varietas peka
(S) yaitu Cisanggang dan Kencana Bali. Untuk analisis ekspresi hanya digunakan
1 varietas tahan (R) yaitu Cisadane dan 1 varietas peka (S) yaitu Kencana Bali.
RNA total yang telah diisolasi dari tanaman tahan dan peka dengan reagen
TRIzol kit digunakan sebagai cetakan untuk sintesis cDNA melalui proses
transkripsi balik (reverse transcription). Primer yang digunakan dalam proses
transkripsi balik pada tahapan ini adalah primer oligo-dT, sehingga hanya mRNA
yang dapat disintesis menjadi cDNA.
Pengujian kemurnian RNA total dari kontaminan protein dilakukan dengan
membandingkan nilai OD (Optical Density) pada panjang gelombang 260 dan
panjang gelombang 280. Rasio OD260/OD280 yang diperoleh berkisar antara 1,50
sampai 1,73. Hal ini menunjukkan terdapat variasi kemurnian RNA dari varietas
padi yang diuji dengan rata-rata OD sebesar 1,57. Keberhasilan pembentukan
cDNA dilihat dengan menggunakan kontrol internal untuk gen penyandi
Ubiquitin yang menghasilkan pita berukuran 265 pb. Selanjutnya cDNA
digunakan untuk analisis ekspresi gen PBZ1 dan PR1.
Ekspresi gen PR1 dan gen PBZ1 pada daun tanaman kontrol baik pada
varietas tahan (Cisadane) maupun peka (Kencana Bali) tidak konstitutif. Hal
tersebut dibuktikan dengan tidak adanya pita pada setiap perlakuan pada tanaman
kontrol. Ekspresi gen PR1 tidak terinduksi baik pada varietas tahan maupun peka
setelah diinfeksi dengan isolat 001M. Hal ini menunjukkan bahwa gen PR1 tidak
terlibat dalam sistem pertahanan tanaman padi indica terhadap serangan patogen
P.grisea isolat 001M.
Ekspresi gen PBZ1 pada varietas tahan (Cisadane) terinduksi pada hari ke-1
setelah infeksi dengan ukuran 563 pb. Ekspresi gen PBZ1 pada varietas peka
(Kencana Bali) terinduksi pada hari ke-7 setelah infeksi dengan ukuran 563 pb
dan ± 900 pb. Hal ini menunjukkan bahwa gen PBZ1 terlibat dalam sistem
pertahanan tanaman padi indica terhadap serangan patogen P.grisea isolat 001M.
Perbedaan amplifikasi gen PBZ1 pada Cisadane dan Kencana Bali disebabkan
oleh adanya perbedaan genotipe, gen Resisten, karakter dan asal persilangan dari
kedua varietas tersebut.
Pada varietas Kencana Bali (peka), terjadi penundaan ekspresi selama enam
hari, sedangkan pada varietas Cisadane (tahan) ekspresi terjadi lebih awal (1 hari),
karena diduga memiliki kemampuan untuk membatasi penetrasi apresorium blas
dan mematikan patogen tersebut serta membentuk hipersensitif (HR). PBZ1
diduga berperan dalam mendegradasi dinding sel patogen yang tersusun oleh
polisakarida atau menghambat patogenesis atau menghambat virulensi patogen
tertentu. Keterlambatan ekspresi gen satu hari dalam sistem pertahanan diduga
sudah bisa membedakan antara varietas yang tahan dan varietas yang peka.
Kata kunci: Ekspresi, Cisadane, Kencana Bali, PR1, PBZ1, Pyricularia grisea.
ABSTRACT
LAELA SARI. Expression of Pathogenesis Related Protein (PR1&PBZ1) Genes
from Indica Rice that Involved in The Tolerance System to Blast Diseases of
Strain 001. Under the direction of UTUT WIDYASTUTI SUHARSONO and
SUHARSONO.
Blast disease caused by Pyricularia grisea could cause high percentage of yield
losses of rice production. Pathogenesis Related protein (PR1&PBZ1) genes have
been known to be involved in plant defense. This research was aimed to test the
expressions of PR genes in resistance and sensitive rice varieties. This research can
be used to give information in rice defense to blast disease and as a strategy to blast
resistance basis. Screening has been done on 5 rice varieties (Asahan, IR64, Cisadane,
Cisanggang and Kencana Bali) for resistance against isolate 001M. Screening was
done by injection of 1 ml inoculum of isolate 001M (3x105 cell/ml) + 0,25 % tween
20, and 1 ml aquadest + 0,25 % tween 20 for the control plant. Results of this
research showed that resistance varieties were Cisadane and Asahan, moderate
resistance variety was IR64, and susceptible varieties were Kencana Bali and
Cisanggang. Expression analysis for PBZ1 and PR1 gene were done by using
Cisadane as a resistance variety and Kencana Bali as a susceptible variety. Analysis
expressions gene were determined using RT-PCR method. Total RNA was isolated
from leave at 0, 1, 3 and 7 days after infection using TRIzol reagent. cDNA synthesis
was carried out using Reverse Transcriptase Superscript III. Expression of PBZ1
gene was observed resistant variety (Cisadane) at 1 day after infection, while
susceptible variety (Kencana Bali) at 7 days after infection. Amplification of PBZ1
Cisadane variety only give 1 band with size about 563 bp, while Kencana Bali variety
give 2 bands with size about 563 bp and 900 bp. PBZ1 gene expression was induced
by Pyricularia grisea strain 001M. It means that PBZ1 gene was involved in the
defense system of rice to P.grisea strain 001M. Amplification of PR1 did not give
any band in both Cisadane and Kencana Bali. PR1 gene expression was not induced
by Pyricularia grisea strain 001M. It means that Pathogen Related 1 (PR1) gene was
not involved in the defense system of rice to P. gisea strain 001M.
Key words: Expression, Cisadane, Kencana Bali, PR1, PBZ1, Pyricularia grisea.
EKSPRESI GEN PENYANDI PATHOGENESIS RELATED
PROTEIN (PR1&PBZ1) PADA PADI INDICA YANG
TERLIBAT DALAM SISTEM TOLERANSI TERHADAP
PENYAKIT BLAS ISOLAT 001
LAELA SARI
Tesis
sebagai salah satu syarat untuk memperoleh gelar
Magister Sains pada
Program Studi Bioteknologi
SEKOLAH PASCASARJANA
INSTITUT PERTANIAN BOGOR
BOGOR
2008
Judul Tesis
:
Nama
NRP
:
:
Ekspresi Gen Penyandi Pathogenesis Related Protein
(PR1&PBZ1) pada Padi Indica yang terlibat dalam Sistem
Toleransi terhadap Blas Isolat 001.
Laela Sari
P055040061
Disetujui
Komisi Pembimbing
Dr. Ir. Utut Widyastuti Suharsono, M.Si.
Ketua
Dr. Ir. Suharsono, DEA.
Anggota
Diketahui
Ketua Program Studi Bioteknologi
Dekan Sekolah Pascasarjana
Dr. Ir. Muhammad Jusuf, DEA
Prof. Dr. Ir. Khairil Anwar Notodiputro, MS.
Tanggal Ujian : 22 Februari 2008
Tanggal Lulus :
Penguji Luar Komisi pada Ujian Tesis: Dr. Ir. Miftahudin, M.Si.
© Hak cipta milik Institut Pertanian Bogor, tahun 2008
Hak cipta dilindungi Undang-Undang
1. Dilarang mengutip sebagian atau seluruh karya tulis ini tanpa
mencantumkan atau menyebutkan sumber.
a. Pengutipan hanya untuk kepentingan pendidikan, penelitian,
penulisan karya ilmiah, penyusunan laporan, penulisan kritik atau
tinjauan suatu masalah.
b. Pengutipan tidak merugikan kepentingan yang wajar IPB.
2. Dilarang mengumumkan dan memperbanyak sebagian atau seluruh
karya tulis dalam bentuk apapun tanpa izin Institut Pertanian Bogor.
PRAKATA
Puji syukur penulis panjatkan kepada Allah Subhanaahu Wa Ta’alaa yang
telah memberikan Rahmat dan kemudahan sehingga penulis dapat menyelesaikan
penelitian maupun penulisan tesis ini.
Penelitian ini bertujuan untuk mengekspresikan gen penyandi Pathogenesis
Related protein (PR1&PBZ1) pada padi Indica yang terlibat dalam sistem toleran
terhadap penyakit blas isolat 001. Penelitian ini dibiayai oleh RUT XI dengan
No. 14.08/SK/RUT/2004, dengan judul ”Analisis Gen Penyandi Protein
Heterotrimerik G Subunit alfa yang terlibat dalam sistem toleransi tanaman padi
terhadap penyakit blas” atas nama Dr. Ir. Utut Widyastuti Suharsono, M.Si.
Pada kesempatan ini, penulis ingin menyampaikan ucapan terima kasih
kepada seluruh pihak yang berperan dalam pengerjaan penelitian dan penulisan
tesis ini. Pertama kepada Dr. Utut W. Suharsono, M.Si. dan Dr. Suharsono, DEA
dan atas segala jerih payah dan waktu yang telah diluangkan dalam memberikan
bimbingan, nasehat, dan arahan kepada penulis. Kedua kepada Dr. Ir. Miftahudin,
M.Si. atas saran dan masukannya. Terima kasih penulis ucapkan kepada Ir. Maria
Imelda, MSc. dan Prof. Dr. Ir Bambang Prasetya yang telah memberikan ijin
untuk menuntut ilmu di IPB serta kepada Kepala LIPI yang telah memberikan
sebagian dana beasiswa. Ucapkan terima kasih juga penulis sampaikan kepada Dr.
Inez Hortenze SL atas diskusi dan bantuannya, Kepada Kepala Pusat Penelitian
Bioteknologi IPB beserta staf dan karyawan atas sarana, prasarana, dan
bantuannya selama penulis melakukan penelitian di Lab. Biologi Molekuler dan
Seluler Tanaman serta Laboratorium Kerjasama Penelitian Bioteknologi
Indonesia-Belanda Biotechnology Research Indonesia- The Netherland (Biorin) di
PP Bioteknologi IPB.
Terima kasih yang tak terhingga penulis sampaikan kepada ayahanda
Soedjono Joyotaruno (Alm.), Ibunda Hajjah Ai Sutarsih, ayahanda Slamet, Ibunda
Miyem, serta suami Budi Murdiyantoro SE atas pengertian, pengorbanan,
dukungan dan doa tiada henti. Terima kasih kepada ananda Aliefa Aviryalashra
Azzahra dan Muhammad Savero Avtariansyah atas segala pengertian, kesabaran
dan kebahagiaan yang selalu menyertai penulis. Kepada adik-adiku dan keluarga,
terima kasih atas dukungan dan doa selama penulis menempuh pendidikan di
Institut Pertanian Bogor.
Kepada rekan seperjuangan Rina Kurnianingsih,Yassier Anwar dan Niken
FG, terima kasih atas kebersamaannya yang tulus, kepada Pak Mulya, Mbak Pepi,
Pak Adi, Pak Mudzuni, Mas Firdaus, Ibu Srilis dan seluruh pihak yang telah
banyak membantu, penulis mengucapkan terima kasih atas dukungan dan
kerjasamanya selama ini.
Akhir kata penulis berharap semoga tesis ini dapat bermanfaat bagi
kemajuan ilmu pengetahuan dan kemajuan bagi bangsa.
Bogor, Februari 2008
Laela Sari
RIWAYAT HIDUP
Penulis dilahirkan di Jakarta pada tanggal 13 Juni 1973 dari Ayahanda
Soedjono Joyotaruno (Alm) dan Ibunda Hajjah Ai Sutarsih. Penulis merupakan
putri pertama dari empat bersaudara. Penulis menikah dengan Budi Murdiantoro,
SE pada tahun 2001 dan telah dikaruniai dua orang anak yaitu: Aliefa
Aviryalashra Azzahra dan Muhammad Savero Avtariansyah.
Tahun 1992 penulis lulus dari SMA Negeri 38 Jakarta Selatan dan pada
tahun yang sama melanjutkan pendidikan di Universitas Nasional dan
memperoleh gelar Sarjana Sains dalam bidang Biologi Umum pada tahun 1997.
Pada tahun yang sama penulis bekerja sebagai tenaga Honorer di Pusat Penelitian
Bioteknologi LIPI- Cibinong, dan sejak tahun 2000 penulis diangkat sebagai
Pegawai Negeri Sipil pada tempat yang sama.
Pada tahun 2002 – sekarang, penulis ditugaskan sebagai penangung jawab
laboratorium Biak Sel dan Jaringan Tanaman 5 (110) Pusat Penelitian
Bioteknologi LIPI. Tahun 2004 penulis mulai menimba ilmu di Institut Pertanian
Bogor (IPB) sebagai mahasiswa Sekolah Pascasarjana Program Studi
Bioteknologi.
DAFTAR ISI
Halaman
DAFTAR TABEL …………………………………..……………………
xiii
DAFTAR GAMBAR ………………………………..……………………
xiv
DAFTAR LAMPIRAN ………………………………..…………………
xv
PENDAHULUAN …………………………………….............…………..
1
Latar Belakang …………………………………………........……....
1
Tujuan Penelitian ...................................................................................
4
Manfaat Penelitian ................................................................................
4
Hipotesis Penelitian ..............................................................................
4
TINJAUAN PUSTAKA .............................................................................
5
Pyricularia grisea Saccardo .................................................................
5
Resistensi Tanaman Padi terhadap Patogen Blas .................................
9
Karakteristik gen PR1 dan gen PBZ1 ...................................................
12
BAHAN DAN METODE ...........................................................................
16
Tempat dan Waktu Penelitian ........ .....................................................
16
Bahan Penelitian ...................................................................................
16
Metode Penelitian ..................................................................................
16
Tahap I: Penapisan Ketahanan Tanaman Padi terhadap Blas ......
18
Persiapan Tanaman Padi ...............................................................
18
Persiapan Inokulum Cendawan untuk Infeksi ..............................
18
Infeksi pada Tanaman Padi ...........................................................
18
Tahap II: Analisis Ekspresi gen PR1 dan gen PBZ1 .....................
19
Isolasi RNA Total .........................................................................
19
Sintesis cDNA Total .....................................................................
20
Analisis Ekspresi gen PR1 dan gen PBZ1 ....................................
21
HASIL DAN PEMBAHASAN ..................................................................
22
Penapisan Ketahanan beberapa Varietas Tanaman Padi terhadap P.
grisea ....................................................................................................
22
Isolasi RNA Total .................................................................................
24
Sintesis cDNA Total................................................................................
25
Analisis Ekspresi gen PR1 dan gen PBZ1 ............................................
26
SIMPULAN DAN SARAN .........................................................................
29
DAFTAR PUSTAKA ..................................................................................
30
LAMPIRAN .................................................................................................
37
xiii
DAFTAR TABEL
Halaman
1.
Ras-ras dominan berdasarkan pola reaksi terhadap varietas
diferensial ..........................................................................................
9
2.
Konsep gene for gene ………………………………………………
11
3.
Skala penyakit blas daun berdasarkan sistem evaluasi standar IRRI
1996 ....................................................................................................
19
4.
Reaksi ketahanan beberapa varietas padi terhadap dua isolat
P. grisea ……………………………………………………………………
22
xiv
DAFTAR GAMBAR
Halaman
1.
Konidia Pyricularia grisea ................................................................
6
2.
Siklus hidup cendawan Pyricularia grisea .......................................
8
3.
Hipotesis Probenazole di dalam sistem pertahanan penyakit tanaman
padi …......…………………………………………………………
14
4.
Alur tahapan penelitian …………………………………………….
17
5.
Serangan blas daun padi pada hari kesepuluh setelah infeksi.Varietas
tahan (R): Asahan (a), Cisadane (b). Varietas moderat tahan (MR):
IR64 (c). Varietas peka (S): Cisanggang (d), Kencana Bali (e) ........
23
6.
Perkembangan spora pada media kaca. (a) 1 jam setelah infeksi, (b)
24 jam setelah infeksi, (c) 48 jam setelah infeksi, (d) 72 jam setelah
infeksi ………………………………………………………………
24
7.
RNA total dari daun tanaman padi kontrol dan yang telah diinfeksi
oleh isolat 001M ……………………………………………………
25
8.
Hasil PCR Ubiquitin yang berasal dari cetakan cDNA …………….
26
9.
Ekspresi gen PR1 dan PBZ1 menggunakan cDNA total dari daun
padi kontrol dan yang telah diinfeksi sebagai cetakan ……………..
27
xv
DAFTAR LAMPIRAN
Halaman
1.
Hasil penapisan isolat 001B dan 001M menurut skala penyakit IRRI 38
1996 ...................................................................................................
2.
Hasil kuantifikasi RNA total .............................................................
39
PENDAHULUAN
Latar Belakang
Padi merupakan tanaman pangan penting di dunia dan merupakan sumber
pangan utama dari sebagian penduduk dunia. Sebagian besar padi ditanam (90 %)
di negara berkembang termasuk Indonesia. Pada tahun 2005 produksi padi
nasional sebesar 54.056.282 ton dengan luas area 11-12 juta ha belum mencukupi
kebutuhan konsumsi penduduk, sehingga pemerintah harus mengimpor beras
sebanyak 939.596 ton (Deptan 2005). Pada tahun anggaran 2006/2007 pemerintah
telah menyepakati untuk mengimpor beras sebanyak 1,5 juta ton (Deptan 2007).
Rendahnya produksi padi dapat disebabkan oleh beberapa faktor, salah satunya
adalah penyakit blas.
Penyakit blas merupakan penyakit berbahaya di Indonesia yang menyerang
padi gogo (Ou 1985; Orbach et al. 2000; Koga 2001). Penyakit ini disebabkan
oleh cendawan Pyricularia grisea Sacc. (Rossman et al. 1990). Cendawan ini
dapat menyerang pada stadia pertumbuhan vegetatif dan stadia reproduktif.
Serangan pada daun dapat menyebabkan berkurangnya luasan daun yang hijau.
Pada intensitas serangan tinggi dapat menyebabkan semua daun menjadi kering
dan mati (Ou 1985). Serangan pada leher malai berkaitan langsung terhadap
kehilangan hasil akibat leher malai busuk dan patah (Bonman et al. 1989)
sehingga bulir padi menjadi hampa (Ahn dan Amir 1986; Kobayashi et al. 2001).
Kerugian akibat penyakit ini diperkirakan mencapai 3 % di Asia Selatan dan
Asia Tenggara (Herdt 1991; Shimamoto et al. 2001), dan secara intensif
menyebabkan gagal panen hingga 50 % (Babujee dan Gnanamanickam 2000). Di
Indonesia serangan penyakit blas diperkirakan sebesar 12 % dari total luas areal
pertanaman padi (Deptan 2004) sehingga diperlukan perhatian lebih khusus
terhadap penyakit blas untuk mengurangi resiko kehilangan hasil panen.
Penyakit blas merupakan salah satu masalah yang mendapat perhatian besar
sehingga program pemulian yang mengarah pada pembentukan varietas yang
tahan ataupun toleran terhadap penyakit blas terus dikembangkan. Perkembangan
terakhir menunjukkan bahwa patogen blas telah menyerang tanaman padi sawah
selain padi gogo. Oleh karena itu perakitan varietas unggul tahan blas telah
2
menjadi salah satu program utama dalam program pemuliaan tanaman selama
beberapa tahun (Amir dan Nasution 2001 ; Utami 2005).
P. grisea diketahui mempunyai keragaman genetik yang tinggi dengan rasras yang dapat berubah sifat virulensinya dalam waktu singkat. Cendawan ini
mempunyai tingkat mutasi spontan dan migrasi antar populasi yang tinggi (Ou
1985) serta memiliki kemampuan rekombinasi baik secara aseksual maupun
seksual (Zeigler 1998), sehingga varietas tahan blas hanya dapat digunakan
selama 1-2 tahun yang sebanding dengan 2-3 kali musim tanam. Ras dominan di
Indonesia yang menyerang padi dan selalu ada pada setiap musim tanam adalah
ras 001, 033 dan 173 (Mogi et al. 1991; Utami et al. 2000). Untuk lebih
memahami mekanisme interaksi tanaman padi dengan blas serta untuk
mengembangkan varietas padi yang lebih tahan terhadap penyakit blas, maka
karakterisasi dari R (resistance) gen sangat diperlukan. Penentuan ras baru dari
patogen blas dilakukan berdasarkan konsep gene for gene, dimana tanaman yang
tahan (resistance) dikontrol oleh gen resistensi (R gene) yang ada pada tanaman
dan gen avirulen (avr) yang ada pada patogen dan selanjutnya mengaktifkan
sistem pertahanan (defense response). (Agrios et al. 1998; Buchanam et al. 2000;
Suharsono et al. 2002).
Secara genetik gen resistensi telah diketahui ada 13 (Kiyosawa 1981), 20
gen mayor berdasarkan QTL yang mengendalikan ketahanan terhadap penyakit
blas (McCouch et al. 1994) dua gen resistensi, yaitu Pi-b (Kawasaki et al. 1999)
dan Pi-ta (Bryan et al. 2000) telah berhasil diisolasi dan diklon. Kajian ketahanan
varietas terhadap penyakit blas telah banyak dilakukan di Indonesia (Kustianto et
al. 1993) tetapi mekanisme signal transduksi yang mengontrol pengaktifan sistem
pertahanan tanaman terhadap patogen masih belum banyak diketahui.
Pengetahuan tentang mekanisme yang terjadi selama proses patogenesis dan
respon yang spesifik dari tanaman merupakan langkah yang sangat penting agar
program pengembangan varietas yang tahan terhadap blas dapat berhasil dengan
baik.
PR gen yang penting pada tanaman padi ada tiga jenis yaitu PR1, PR5 dan
PR10 (PBZ1). PBZ1 protein dan PR1 protein pada tanaman berperan dalam
mengaktifkan sistem pertahanan tanaman terhadap patogen (Agrawal et al. 2001;
3
Gee et al. 2001; Nakhasita et al. 2001). H2O2 akan berperan sebagai second
messengers untuk mengaktifkan ekspresi gen pertahanan pada tumbuhan,
diantaranya adalah PR1 dan PBZ1. Adanya aliran ion Ca2+ sebagai isyarat bagi
pengaktifan enzim MAP kinase (Mitogen Activated Kinase) dalam pembentukan
pathogenesis related (PR) protein, dapat mengaktifkan reaksi hipersensitif dan
ketahanan penyakit blas. Tanaman padi yang terinduksi oleh serangan patogen
blas akan mengaktifkan kelompok gen famili (family genes) yang menyandi PR
protein sebagai respons dari sistem pertahanannya (Gee et al. 2001; Heisser et al.
2005). PR protein ini dapat mendegradasi dinding sel patogen yang tersusun oleh
polisakarida atau menghambat patogenesis atau menghambat virulensi patogen
(Hammond-Kosack dan Jones 1997).
PBZ1 dan PR1 protein mempengaruhi respon ketahanan di dalam tanaman
padi melawan cendawan. PR1 merupakan protein yang pertama kali berhasil
diidentifikasi dan merupakan kelompok yang paling dominan dari PR protein.
Protein ini berfungsi sebagai antifungal (Selitrennikoff 2001). Gen PR1 dapat
diinduksi oleh patogen, diantaranya Magnaporthe grisea, Bipolaris sorokiniana
dan Pseudomonas syringae pv. Syringae (Schweizer et al. 1997), juga dapat
diinduksi oleh bahan kimia seperti salicylic acid (SA) dan benzo (1,2,3)
thiadiazole-7-carbothioic acid S-methyl ester (BTH) (Kim et al. 2002).
Ekspresi gen PBZ1 pada tanaman padi dapat diinduksi oleh probenazole (3allyloxy-1, 2-benzisothiazole-1, 1-dioxide) yang dapat meningkatkan aktifitas
enzim yang berkaitan dengan sistem pertahanan pada tanaman, seperti
peroksidase, polyphenoloxidase, ammonia-lyase dan asam α-linolenat yang
berfungsi sebagai penghambat perkecambahan konidia. Sehubungan dengan
tatanama yang dibentuk dari protein intraselular dengan karakteristik yang sama
maka PBZ1 disebut juga sebagai PR10 (Agrawal et al. 2001; Nakhashita et al.
2001).
Ekspresi gen PR1 dan PBZ1 pada padi japonica secara spesifik diinduksi
oleh ras blas (Magnophorthe grisea) yang bersifat avirulen dan dihambat oleh ras
blas yang bersifat virulen. Hal ini menunjukkan bahwa kedua gen ini berperan
dalam sistem pertahanan tanaman padi terhadap penyakit blas yang diperantarai
oleh gen resistensi (R gene) (Suharsono et al. 2002). Studi ekspresi gen PR1 dan
4
gen PBZ1 pada padi indica belum dilakukan, padahal padi indica merupakan
sumber genetik untuk gen resistensi terhadap penyakit blas (Ramli 2000),
sehingga kajian tentang keterlibatan gen penyandi Pathogenesis Related protein
PR1 dan gen penyandi Pathogenesis Related protein PBZ1 terhadap blas pada
padi indica sangat penting untuk dilakukan.
Tujuan Penelitian
Tujuan dari penelitian ini adalah untuk mempelajari ekspresi gen penyandi
Pathogenesis Related Protein (PR1 & PBZ1) dari tanaman padi indica yang
diinfeksi dengan P. grisea penyebab penyakit blas.
Manfaat Penelitian
Penelitian ini diharapkan memberi informasi mengenai mekanisme sistem
pertahanan tanaman padi terhadap penyakit blas sehingga bisa digunakan sebagai
landasan untuk merakit tanaman tahan blas.
Hipotesis Penelitian
Ekspresi gen PR1 dan PBZ1 pada tanaman padi indica diinduksi oleh
infeksi cendawan P. grisea (Isolat 001).
TINJAUAN PUSTAKA
Pyricularia grisea Saccardo
Pada tahun 1637 Soong Yin-Shin di Cina dalam bukunya “Utilization of
Natural Resources” telah melaporkan adanya penyakit padi yang dikenal sebagai
rice fever. Penyakit ini dinamakan blas oleh Mescalf, yang dikenal dengan bercak
daun belah ketupat (Ou 1985). Pada tahun 1880 Pyricularia grisea Saccardo
ditemukan pada rumput tropik, kemudian tahun 1891 Pyricularia oryzae Cavvara
ditemukan pada tanaman padi. Pada tahun 1918 baru diketahui bahwa penyakit
blas disebabkan oleh Pyricularia grisea Saccardo (Rossman et al. 1990) yang
merupakan faktor pembatas produksi padi (Oryza sativa L.) di seluruh dunia.
Kerugian akibat penyakit ini diperkirakan mencapai $55 juta/tahun di Asia
Selatan dan Asia Tenggara (Herdt 1991). Saat ini telah diketahui 67 nama jenis
Pyricularia, tiga diantaranya adalah Pyricularia jenis baru (P. kookicola
Bussaban, P. longispora Bussaban, P. variabilis Bussaban) dan studi molekuler
telah memastikan bahwa Pyricularia grisea dan P. oryzae adalah identik (Lebrun
et al. 1991; Bussaban et al. 2003).
Penyakit ini muncul di lahan kering dan kemudian di lahan sawah yang
agak cenderung kering. Cendawan blas dapat menginfeksi tanaman padi pada
setiap tahapan pertumbuhannya dengan membentuk bercak baik pada daun, ruas
batang, leher malai, cabang malai dan kulit gabah yang dapat menyebabkan
kehampaan pada biji sehingga bisa mengakibatkan kegagalan panen (Ou 1985;
IRRI 2003).
Cendawan ini ditemukan di alam dalam bentuk aseksual, sedangkan dalam
bentuk seksualnya yaitu Magnoporte grisea (Hebert) Barr hanya diproduksi
dengan pembiakan di laboratorium. Kehilangan hasil padi akibat blas leher malai
(neck blast) dapat mencapai lebih dari 80 % (Chen 1993). Serangan patogen pada
buku batang (node blast) dapat menyebabkan batang patah (Ou 1985) dan
kematian yang menyeluruh pada batang sebelah atas dari buku yang terinfeksi.
Sedangkan serangan P. grisea pada leher malai memperlihatkan gejala nekrotik
yang berwarna abu-abu. Infeksi pada buku leher menyebabkan busuk pada leher
yang sangat berbahaya bagi tanaman. Bercak yang terjadi pada malai padi
6
biasanya berwarna coklat dan bisa pula berwarna hitam yang semuanya terjadi
akibat hifa yang berkembang membentuk konidiofor dan penetrasi aktif konidia
yang matang (Gambar 1) (Zhao et al. 2007).
20 µm
Keterangan : A=apresorium, C= konidia G = tabung infeksi
ukuran skala Bars 20 µm,
Gambar 1. Konidia Pyricularia grisea (Zhao et al. 2007).
Gejala daun yang terserang oleh blas daun (leaf blast) berupa bercak
berbentuk belah ketupat dengan ujung yang runcing. Pada bagian tengah bercak
berwarna abu-abu atau putih yang dikelilingi warna coklat sampai coklat
kemerahan pada bagian pinggir bercak (Ou 1985). Bentuk warna dan ukuran
bercak tersebut bervariasi tergantung pada ketahanan varietas, umur tanaman dan
umur bercak tersebut (Scardaci et al. 1997). Pada varietas yang tidak tahan, pada
kondisi lingkungan yang lembab, pinggiran bercak berwarna coklat dengan sedikit
kuning (halo), sedangkan pada varietas yang tahan, bercak tidak berkembang
melainkan hanya berupa titik coklat saat penetrasi sebesar jarum. Hal ini
disebabkan adanya reaksi hipersensitif yang cepat dari tanaman inang sehingga
patogen tidak berkembang (Ou 1985).
Cendawan P. grisea yang menyebabkan penyakit mempunyai 3 fase
pertumbuhan, yaitu: infeksi, kolonisasi dan sporulasi. Fase infeksi, diawali dengan
penetrasi aktif konidia pada permukaan daun ke dalam sel epidermis tanaman padi
(Koga 2001). Penetrasi ini diperantarai oleh tekanan mekanik melalui proses
enzimatik. Selanjutnya konidia akan menghasilkan tabung kecambah (germ tube)
yang akan membentuk apresorium. Pada kondisi yang cocok dan lembab,
apresorium akan menghasilkan tabung infeksi (haustoria) yang akan menembus
7
sel epidermis pada permukaan daun padi. Kemudian hifa akan berkembang dalam
sel tanaman dan akan menyebabkan bercak (Leung dan Shi 1994).
Pada kelembaban yang tinggi, pada tanaman yang peka, bercak akan
menghasilkan konidia dalam waktu 3-4 hari. Apresorium tidak mampu melakukan
penetrasi pada sebagian varietas tahan akibat adanya kandungan silikat pada
dinding sel epidermis. Produksi spora akan meningkat seiring dengan
meningkatnya kelembaban udara dan kebanyakan spora yang dihasilkan
dilepaskan ke udara (air borne) pada malam hari, yang merangsang
perkembangan penyakit (Scardaci et al. 1997; IRRI 2003).
Menurut Bonman et al. (1987) penyakit blas lebih menyukai kondisi
periode embun yang panjang, kelembaban yang tinggi, sedikit ada angin pada
malam hari dan temperatur malam sekitar 22 oC – 29 oC. Daun yang basah yang
berasal dari embun ataupun sumber lain sangat dibutuhkan untuk infeksi. Spora
dihasilkan dan dilepaskan pada kondisi kelembaban relatif yang tinggi, dan tidak
ada spora yang dihasilkan pada kondisi kelembaban dibawah 89 %. Sporulasi
meningkat apabila kelembaban relatif diatas 93 %, sedangkan temperatur
optimum untuk perkecambahan spora, pembentukan bercak dan sporulasi adalah
28 oC pada kelembaban 95 % dengan kondisi gelap selama 15 jam (Ou 1985).
Blas daun terjadi antara fase persemaian, sedangkan busuk leher terjadi setelah
pembentukan malai. Infeksi oleh cendawan blas umumnya dimulai pada saat
benih disemai di bak persemaian (Ahn dan Amir 1986; IRRI 2003).
Cendawan P. grisea mempunyai banyak ras dan ras-ras tersebut dapat
berubah dan terbentuk ras baru dengan cepat apabila populasi tanaman atau sifat
ketahanan tanaman berubah. Konidia yang dihasilkan oleh bercak blas dapat
menjadi ras baru yang memiliki patogenitas yang berbeda. Keragaman yang tinggi
ini disebabkan oleh kemampuannya dalam melakukan perkawinan antar haploid
hifa yang berlainan material genetiknya (Parasexual exchanged DNA) (Ou 1985;
Zeigler 1998). Mutasi, seleksi dan aliran gen diantara populasi, dan rekombinasi
genetik merupakan faktor utama yang menentukan struktur genetik dan dinamika
populasi cendawan ini (Kiyosawa 1981). Disamping itu variasi pada cendawan
blas disebabkan oleh adanya elemen transposon POT2 dalam genomnya
(endogenous repetitive DNA sequences). Elemen ini merupakan salah satu elemen
8
sekuen berulang (selain sekuen berulang MGR) yang tersebar pada genom
cendawan blas. Elemen transposon POT2 ini mempunyai sekuen terminal
inverted repeat dan sekuen internal yang diduga sebagai sekuen transposase.
Sekuen transposase ini berperan dalam penyisipan elemen transposon ke dalam
kromosom lain untuk membentuk rekombinan baru (Kachroo et al. 1994).
Menurut Kiyosawa (1981) dan Tenjo dan Hamer (2002) cendawan P. grisea
mempunyai ras patogenik yang berbeda kemampuannya dalam menginfeksi
varietas padi, dan merupakan salah satu cendawan yang menunjukkan variasi serta
diklasifikasikan dalam beberapa ras berdasarkan kemampuan menginfeksi pada
tanaman padi differensial. Terjadinya infeksi dan penyakit oleh cendawan P.
grisea meliputi penempelan konidia pada permukaan inang, perkecambahan
konidia, pembentukan apresorium, penetrasi, pertumbuhan invasif dan sporulasi
(Gambar 2) (Zhao et al. 2007).
Konidia
Sporulasi
Perkecambahan
Perkembangan apresorium
Pertumbuhan invasif
Penetrasi
Gambar 2. Siklus hidup cendawan Pyricularia grisea (Zhao et al. 2007).
Faktor yang mendukung perkembangan penyakit blas, antara lain adalah
pemakaian pupuk nitrogen yang berlebihan, tanah dalam kondisi aerobik dan stres
kekeringan. Kandungan nitrogen yang tinggi mengakibatkan peningkatan nitrat
dalam tanah sehingga meningkatkan kerentanan tanaman terhadap penyakit ini.
Nitrogen amonium diubah menjadi nitrat apabila tanah mempunyai drainase dan
aerasi yang baik (Scardaci et al. 1997).
9
Menurut Mogi et al. (1991) tujuh varietas lokal ditetapkan sebagai varietas
diferensial berdasarkan reaksi patotipe-nya yang khas terhadap ras-ras dominan
yang ditemukan di beberapa lokasi endemik penyakit blas di Indonesia. Adapun
varietas lokal yang ditetapkan sebagai varietas diferensial adalah Asahan,
Cisokan, IR64, Kruwing Aceh, Cisadane, Cisanggang dan Kencana Bali
(Tabel 1).
Belum tersedianya informasi mengenai varietas diferensial (differential
variety) tanaman padi untuk ketahanan terhadap penyakit blas pada daerah tropika
akan menyulitkan di dalam mempelajari mekanisme sinyal tranduksi di dalam
sistem ketahanan padi (Fucuta et al. 2002).
Tabel 1. Ras-ras dominan berdasarkan pola reaksi terhadap varietas diferensial.
Varietas
Nomor kode ras-ras dominan
Nilai
diferensial
001
003
011
013
021
041
051
101
111
113
133
201
skor
Asahan
R
R
R
R
R
R
R
R
R
R
R
S
200
Cisokan
R
R
R
R
R
R
R
S
S
S
S
R
100
IR64
R
R
R
R
R
S
S
R
R
R
R
R
40
K.Aceh
R
R
R
R
S
R
R
R
R
R
S
R
20
Cisadane
R
R
S
S
R
R
S
R
S
S
S
R
10
Cisanggang
R
S
R
S
R
R
R
R
R
S
S
R
2
K.Bali
S
S
S
S
S
S
S
S
S
S
S
S
1
Keterangan : R = tahan ; S = peka
(Sumber Mogi et al. 1991)
(Semakin besar nomor kode ras-ras dominan di Indonesia diatas maka bersifat semakin virulen).
Resistensi Tanaman Padi terhadap Patogen Blas
Ada dua kelompok klasifikasi ketahanan tanaman terhadap suatu penyakit,
yaitu ketahanan vertikal (vertical resistance) dan ketahanan horizontal (horizontal
resistance). Ketahanan vertikal bersifat monogenik/oligogenik (adanya gen
mayor) dan hanya efektif terhadap ras-ras spesifik saja dan menunjukkan bebas
bercak atau sangat tahan (hypersensitive). Interaksi yang terjadi antara gen mayor
dan patogen adalah inkompatible, di mana gen mayor ini langsung mengenali
patogen sehingga dapat menghambat siklus hidupnya (Finckh 1994), seperti tujuh
gen ketahanan mayor yaitu gen Pik, Pik-h, Piz, Piz5, Pil, Pi7(t) dan Pik-m, yang
dapat digunakan sebagai sumber gen ketahanan terhadap blas dalam perakitan
10
piramiding gene tanaman padi (Reflinur 2005). Sedangkan ketahanan horizontal
bersifat poligenik (adanya gen minor) dan tahan terhadap banyak ras patogen
sehingga bersifat tidak spesifik (McCouch et al. 1994; Agrios 1998). Patogen
menyerang tanaman melalui dua cara yaitu necrotropy dan biotropy. Necrotropy
merupakan patogen yang membunuh sel inang dengan cara menghasilkan
enzim/toksin tertentu sehingga mampu menghambat mekanisme pertahanan
tanaman inang, contohnya blas. Biotropy adalah patogen yang menyerang sel
hidup dan mengubah metabolisme tanaman untuk mendukung pertumbuhan dan
reproduksi patogen (Hammond-Kosack dan Jones 1997).
Reaksi tanaman padi terhadap penyakit blas dibagi menjadi tiga yaitu tahan
(completely resistant), moderat (partially resistant) dan peka (susceptible).
Cendawan tidak dapat menimbulkan bercak sama sekali pada varietas tahan
(Correa-viktoria dan Zeigler 1995). Untuk lebih memahami mekanisme interaksi
tanaman padi dengan patogen blas serta untuk mengembangkan varietas padi yang
lebih tahan terhadap penyakit blas, maka isolasi maupun karakterisasi dari gen
resistensi (R gene) sangatlah dibutuhkan.
Pengenalan patogen oleh tanaman yang tahan, dikontrol oleh gen resistensi
(R gene) yang ada pada tanaman dan gen avirulen (Avr) yang ada pada patogen.
Hal ini akan mengaktifkan sistem pertahanan (defense response) tanaman
terhadap patogen. Interaksi antara patogen dan inang dijabarkan dalam konsep
gene for gene (Tabel 2), dimana untuk setiap lokus genetik ada yang mengatur
ketahanan atau kerentanan tanaman inang dan ada lokus yang mengatur virulen
atau tidaknya suatu patogen, sehingga jika ada gen dalam tanaman inang yang
berperan untuk memberikan ketahanan maka ada pula gen dalam patogen yang
berperan untuk meningkatkan virulensinya agar dapat mematahkan ketahanan
inang yang bersangkutan (Staskawicz et al. 1995). Kendala yang sering dihadapi
di lapangan adalah terputusnya ketahanan suatu varietas terhadap penyakit karena
patogen berhasil beradaptasi membentuk ras baru sehingga berhasil menyerang
varietas yang sebelumnya sudah diidentifikasi bersifat resisten.
Studi genetika untuk mendapatkan gen resistensi terhadap penyakit blas
telah banyak dilakukan. Tanaman padi telah ditemukan lebih dari 25 gen mayor
yang mengendalikan ketahanan terhadap penyakit blas (Naqvi dan Chatto 1996)
11
dan 2 gen resistensi, yaitu Pi-b (Kawasaki et al. 1999) dan Pi-ta (Bryan et al.
2000) telah berhasil diisolasi dan diklon. Kedua gen resisten ini mempunyai
struktur gen yang mirip, yaitu NBS (nucleotide binding site) dan LRR (leucine rich
repeat). NBS dan LRR ini juga merupakan ciri pada gen resisten tanaman lain
yang sudah berhasil diisolasi, seperti gen resisten Hml pada jagung, RPS2 dan
RPMI pada Arabidobsis, Cf-9 pada tomat (Jones et al. 1994). Masing-masing gen
tersebut (Pi) akan berinteraksi secara spesifik dengan ras-ras tertentu dari
cendawan P. grisea (Ou. 1985). Saat ini terdapat 30 lokus ketahanan terhadap blas
yang telah diidentifikasi berdasarkan QTL pada padi, 20 diantaranya adalah gengen mayor yang mengatur ketahanan terhadap penyakit blas, sebagai contoh
adalah gen Pi-1, Pi-2, Pi-4, Pi-5, Pi-7 dan Pi-zh (Wang et al. 1989; Yu et al.
1991; McCouch et al. 1994).
Tabel 2 Konsep gene for gene
Genotip
Genotip Tanaman Inang
Patogen
Avr
avr
R
r
Inkompatibel
Kompatibel
(Tidak Terjadi Penyakit)
(Penyakit)
Kompatibel
Kompatibel
(Penyakit)
(Penyakit)
(Sumber Flor 1971 dalam Buchanam et al. 2000)
Beberapa usaha pengendalian terhadap penyakit blas telah dilakukan, antara
lain adalah penggunaan varietas tahan, penggunaan pupuk yang berimbang dan
pemakain fungisida (Amril 1992). Di antara usaha pengendalian tersebut,
penggunaan varietas tahan merupakan metode yang sangat praktis dan ekonomis
bagi petani serta ramah lingkungan. Akan tetapi ketahanan suatu varietas terhadap
penyakit blas tidak dapat bertahan lama karena cendawan P. grisea mempunyai
banyak ras dan ras-ras tersebut berubah dengan cepat dimana selama 21 bulan
pengamatan ditemukan keragaman jumlah, komposisi dan frekuensi ras diantara
bulan-bulan pengamatan (Ou 1985). Di Sumatera Barat selama tiga tahun telah
12
ditemukan adanya perubahan profil DNA dari tahun ke tahun (Utami et al. 2000).
Hasil penelitian mengenai penyakit blas memperlihatkan bahwa kendali genetik
ketahanan terhadap penyakit blas dapat berbeda-beda tergantung varietas padi
yang digunakan dan jenis isolat uji yang dipakai.
Toriyama et al. (1996) menyatakan metode pengembangan varietas padi
tahan blas dapat dilakukan dengan penggabungan beberapa gen tahan dominan
(true resistence) pada satu varietas, pembentukan varietas dengan beberapa gen
ketahanan horizontal (field resistance), dan penggabungan gen-gen ketahanan true
resistance dan field resistance, serta perakitan varietas-varietas multiline. Usaha
pemulia tanaman dalam merakit varietas padi yang memilki ketahanan terhadap
penyakit blas telah banyak dilakukan di Indonesia, tetapi mekanisme induksi yang
mengontrol pengaktifan sistem pertahanan tanaman terhadap patogen masih
belum terungkap.
Mekanisme yang terjadi selama patogenesis dan respon yang spesifik dari
tanaman merupakan langkah yang sangat penting untuk dipahami agar program
pengembangan varietas yang tahan terhadap blas dikemudian dapat berhasil
dengan baik (Koga 2001). Oleh karena itu perakitan varietas padi tahan blas harus
dilakukan dengan cepat dan berkesinambungan serta disesuaikan dengan
komposisi ras cendawan P. grisea yang berkembang di lapangan (Kustianto et al.
1993; Amir 2002).
Karateristik gen PR1 dan gen PBZ1
Tanaman akan bereaksi terhadap kehadiran suatu patogen dengan
mengaktifkan suatu multikomponen sistem pertahanan. Diawali dengan sinyal
transduksi yang mengubah stimulus menjadi bentuk yang lain dengan melibatkan
urutan reaksi biokimia di dalam sel yang dilaksanakan oleh enzim dan
berhubungan melalui second messenger (Voet dan Donald 1995). Terdapat tiga
mekanisme utama dalam proses penerimaan sinyal dan inisiasi transduksi sel
dalam merespon sinyal dari lingkungan yaitu penerimaan sinyal oleh sel target,
penguatan sinyal, respon seluler terhadap sinyal sehingga mengaktifkan
downstream seperti pada Phatogenesis Related (PR). Tanaman padi yang
13
terinduksi oleh serangan patogen blas akan mengaktifkan kelompok gen (family
genes) yang menyandi kode PR protein (Gee et al. 2001; Heisser et al. 2005).
Proses interaksi pada tanaman meliputi tahapan seperti pengenalan oleh
gen R, aktivasi protein kinase, aktivasi kelompok gen Rac, fosforilasi bertingkat
dan timbulnya respon pertahanan tanaman yang berupa diproduksinya senyawa
fitoaleksin dan PR protein seperti pada PR1 dan PBZ1 (Shimamoto et al. 2001).
Gen PR1 dan gen PBZ1 merupakan Phatogenesis Related protein (PR protein),
yaitu gen-gen yang aktif sebagai reaksi tanaman terhadap infeksi patogen.
Gee et al. (2001) menjelaskan over expresi gen PR dari kayu cendana dapat
meningkatkan sistem pertahanan tanaman terhadap patogen tertentu. PR protein
ini dapat mendegradasi dinding sel patogen yang tersusun oleh polisakarida atau
menghambat patogenesis atau mungkin juga dapat meningkatkan resistensi
terhadap beberapa patogen
dan juga menunjukkan anti mikroba (Hammond-
Kosack dan Jones 1997: Gee et al. 2001).
Menurut Agrawal et al. (2001) etilen terlibat dalam ekspresi gen
pathogenesis-related (PR) yang terdapat pada tanaman dikotil, tetapi hanya
sedikit gen PR yang diidentifikasi dan karakterisasi pada tanaman monokotil
seperti padi, dan beberapa jenis gandum. Ternyata etilen mempengaruhi terhadap
tiga gen penting gen PR pada padi (kultivar Nipponbare) seperti, gen PR10, PR1
dan PR5 terhadap perkecambahan daun. Hasil ini menandai adanya suatu peran
dinamis untuk etilen di dalam gen PR yg diinduksi di dalam tanaman padi.
Menurut Agrawal et al. 2001 terdapat tiga gen penting dalam tanaman padi yaitu
gen PR1, PR5 dan PR10 (PBZ1).
Empat belas famili dari PR protein (PR1–PR14) telah diketahui dan
diidentifikasi berdasarkan fungsi atau karakteristik strukturnya (Van Loon dan
Van Strein 1999). PR1 merupakan gen yang pertama kali berhasil diidentifikasi
dan merupakan kelompok yang paling dominan dari PR protein. Protein ini
berfungsi sebagai antifungal (Selitrennikoff 2001). Protein PR1 terakumulasi oleh
infeksi patogen, induksi bahan kimia seperti salicylic acid (SA) dan benzo (1,2,3)
thiadiazole-7-carbothioic acid S-methyl ester (BTH) (Kim et al. 2002; Shimono et
al. 2007).
14
Pada tanaman padi, ekspresi gen PR1 diinduksi oleh infeksi patogen,
diantaranya Magnaporthe grisea, Bipolaris sorokiniana dan Pseudomonas
syringae pv. Syringae (Schweizer et al. 1997). Walaupun fungsi secara biokimia
protein PR masih banyak yang belum diketahui, tetapi ada beberapa contoh yang
memiliki anti mikroba seperti PR3 dan PR2 yang dapat menghambat pertumbuhan
cendawan dan dapat mendegadrasi sel dinding cendawan sehingga terjadi
penurunan kerusakan penyakit setelah di infeksi oleh cendawan patogen (Gee et
al. 2001).
Protein PBZ1 mempengaruhi respon ketahanan di dalam tanaman padi
melawan cendawan (Van loon et al. 1994). Ekspresi gen ini pada tanaman padi
dapat diinduksi oleh probenazole (3-allyloxy-1, 2-benzisothiazole-1, 1-dioxide)
yang dapat meningkatkan aktifitas enzim yang berkaitan dengan sistem
pertahanan pada tanaman, seperti peroksidase, polyphenoloxidase, ammonia-lyase
dan catechol-O-methyltransferase serta asam α-linolenic yang berfungsi sebagai
penghambat perkecambahan konidia (Gambar 4) (Iwata 2001).
Aktivasi sistem
pertahanan alami
PBZ1, PR1-------- ?
B
L
A
S
F
u
n
g
i
s
i
d
a
Ekspresi
PR
Membran sel
Dinding sel
Hipersensitif
Gambar 3. Hipotesis Probenazole di dalam sistem pertahanan penyakit tanaman
padi (Iwata 2001).
Ekspresi gen PBZ1 dapat juga diinduksi oleh vitamin B1 (Ahn et al. 2005),
dan diinduksi oleh bakteri hawar (Suharsono et al. 2002). Baru-baru ini, peneliti
melaporkan banyak gen pertahanan berhubungan di dalam tanaman padi yang
15
diinduksi oleh aplikasi probenazole (Shimono et al. 2000). Sehubungan dengan
tatanama yang dibentuk protein intraselular dengan karakteristik yang sama maka
PBZ1 disebut juga sebagai PR10 (Agrawal et al. 2001; Nakhashita et al. 2001).
Ekspresi gen PR1 dan PBZ1 pada padi japonica secara spesifik diinduksi
oleh ras blas (Magnophorthe grisea) yang bersifat avirulen dan dihambat oleh ras
blas yang bersifat virulen. Hal ini menunjukkan bahwa kedua gen ini berperan
dalam sistem pertahanan tanaman padi terhadap penyakit blas yang diperantarai
oleh gen resistensi (R gene) (Suharsono et al. 2002). Studi gen PR1 dan gen PBZ1
pada padi indica belum dilakukan, padahal padi indica merupakan sumber genetik
untuk gen resistensi terhadap penyakit blas (Ramli 2000).
BAHAN DAN METODE
Tempat dan Waktu Penelitian
Penelitian dilaksanakan dari bulan Juni 2005 sampai dengan bulan
November 2007 di rumah kaca, Laboratorium BIORIN (Biotechnology Research
Indonesian-The Netherlands) dan Laboratorium Genetika Molekuler dan Seluler
Tanaman, Pusat Penelitian Sumberdaya Hayati dan Bioteknologi (PPSHB) Institut
Pertanian Bogor.
Bahan Penelitian
Bahan yang digunakan dalam penelitian penapisan ketahanan padi terhadap
blas terdiri dari 5 varietas yaitu Asahan, IR64, Cisadane, Cisanggang dan Kencana
Bali. Isolat Pyricularia grisea 001B koleksi BB-Biogen Bogor dan isolat 001M
koleksi Kebun Percobaan Muara, Balai Penelitian Padi, digunakan sebagai bahan
infeksi.
Isolasi RNA menggunakan Kit Trizol (Invitrogen). Primer spesifik PBZ1
forward (5’CAGTGGTCAGTAGAGTGATC3’) dan primer PBZ1 reverse
(5’CTGGATAGAGGCAGTATTCC3’) (R) (Midoh & Iwata 1996) digunakan
untuk amplifikasi cDNA dari PBZ1 dengan ukuran sebesar 563 pb. Primer
spesifik PR1 (rPR1-1) (5’TAACTATGGAGGTATCCAAGCTGCC3’) dan
primer PR1 (rPR1-2) (5’CCAGTACGTACGCCCGTGTGTATAA3’) (Van Loon
& Van Strein 1999) digunakan untuk amplifikasi cDNA dari PR1 dengan ukuran
523 pb. Primer Ubiquitin(F) forward (5’CCAGGACAAGATGATCTGCC3’) dan
primer Ubiquitin (R) reverse (5’AAGAAGCTGAAGCATCCAGC3’) (Izawa et
al. 2002) yang didesain dari tanaman padi digunakan untuk amplifikasi cDNA
dari Ubiquitin dengan ukuran sebesar 265 pb.
Metode Penelitian
Penelitian ini dibagi ke dalam dua tahap (Gambar 5). Tahap I adalah
penapisan ketahanan berbagai varietas padi indica terhadap P. grisea isolat 001.
Tahap II adalah analisis ekspresi gen PBZ1 dan gen PR1.
17
5 Varietas Padi:
Asahan, IR 64,
Cisadane,
Cisanggang dan
Kencana Bali
T
A
H
A
P
Infeksi Pyricularia
grisea
I
Varietas
Tahan
dan
Varietas
Peka
Infeksi Pyricularia
grisea
Isolasi RNA Total
0, 1, 3 dan 7 Hari
Transkripsi Balik
cDNA
Total
Analisis Ekspresi gen
PR1 dan PBZ1
Gambar 4. Alur Penelitian
T
A
H
A
P
II
18
Tahap 1: Penapisan ketahanan tanaman padi terhadap blas
Persiapan tanaman padi
Bulir padi dikecambahkan pada kertas merang basah dalam baki selama 3
hari dalam ruang gelap. Setelah berkecambah ditanam pada bak plastik berukuran
25x35x15 cm berisi media dengan komposisi adalah: tanah : kompos : pasir
(3 : 1 : 0.5). Masing-masing varietas ditanam sebanyak 10 benih dan dibuat untuk
2 seri dengan 3x ulangan, yaitu untuk isolat 001B asal BB-Biogen dan isolat
001M asal Kebun Percobaan Muara, Balitpa.
Persiapan inokulum cendawan untuk infeksi
Kultur miselia cendawan dilakukan dengan cara memotong miselia
cendawan yang tumbuh di media PDA (Potato Dextrose Agar). Cendawan
dipotong-potong (ukuran 3 mm x 3 mm) dengan menggunakan jarum (transfer
needle) steril. Sebanyak 3 potongan dimasukkan kedalam petri yang berisi media
V8 (jus sayur-sayuran V8 100 ml/l, sukrosa 5 g/l, soluble starch 1 g/l, yeast
extract 1 g/l dan bacto agar 16 g/l serta pH 6,8). Inkubasi dilakukan selama 8 hari
pada suhu ruang. Selanjutnya miselia dipindahkan ke media sporulasi yaitu media
oat (oat 30 g/l, sukrosa 5 g/l, agar 16 g/l) selama 8 hari untuk dilakukan maserasi.
Miselia cendawan dalam cawan dicuci dengan ddH2O steril menggunakan objek
glass steril kemudian diletakkan pada lemari sporulasi dan disinari dengan lampu
flourosense ± 40 watt selama 10 hari.
Konidia dipanen dengan cara mencuci menggunakan gelas objek. Kerapatan
konidia yang digunakan untuk infeksi adalah sebanyak 3 x 105 spora/ml (sel/ml)
yang dihitung menggunakan haemacytometer. Sebelum dilakukan infeksi larutan
suspensi ditambahkan tween 20 dengan konsentrasi 0,25 % (v/v). Kemampuan
menginfeksi dilihat dari konidia membentuk apresorium pada media kaca yang
disimpan pada tempat yang lembab.
Infeksi pada tanaman padi.
Infeksi dilakukan pada tanaman padi yang berumur 14-21 hari setelah tanam
(mempunyai ± 5 daun). Infeksi dilakukan mengikuti metode Chen et al. 1995
dengan modifikasi yaitu dengan cara menginjeksikan konidia 1 ml/tanaman pada
19
bagian batang (pelepah) tanaman padi tersebut. Setelah infeksi, tanaman
diinkubasi semalam dalam ruang gelap dan dipindahkan ke ruang terang dengan
kelembaban 93-95 % suhu 28-30 ºC selama 6 hari. Pengamatan terhadap serangan
blas daun dilakukan 7 hari setelah infeksi dengan menskoring (skala 0-skala 9)
tipe reaksi penyakit berdasarkan Standard Evaluation System for rice (IRRI 1996)
(Tabel 3).
Tabel 3. Skala penyakit blas daun berdasarkan sistem evaluasi standar IRRI 1996.
Skala
Gejala
0
Tidak ada bercak
1
Bercak kecil sebesar ujung jarum, coklat tanpa ada pusat sporulasi
2
Bercak abu-abu bundar agak lonjong Ø 1-2 mm, tepi warna coklat
3
Tipe bercak sama dengan skala 2, umumnya ditemukan pada daun atas
4
Bercak khas blas berukuran 3 mm, luas daun terinfeksi kurang dari 4 %
5
Bercak khas blas, luas daun terinfeksi 4 % - 10 %
6
Bercak khas blas, luas daun terinfeksi 11 % - 25 %
7
Bercak khas blas, luas daun terinfeksi 26 % - 50 %
8
Bercak khas blas, luas daun terinfeksi 51 % - 75 %
9
Luas daun terinfeksi lebih dari 75 %
Ket. Skala 0-3 tahan (R), skala 4-5 moderat tahan (MR), skala 6 moderat rentan
(MS) skala 7-9 peka (S)
Tahap II: Analisis Ekspresi gen PR1 dan PBZ1
Isolasi RNA total
Isolasi RNA total dilakukan dari tanaman yang telah diinfeksikan dengan
isolat 001M pada 0, 1, 3 dan 7 hari setelah infeksi. Isolasi RNA daun padi
dilakukan dengan menggunakan Kit TRIzol (Invitrogen). Sebanyak 50 – 80 mg
daun ditambah N2 cair digerus di dalam cawan sampai berbentuk bubuk halus
yang kemudian dicampur dengan 800 µl Kit TRIzol. Campuran diinkubasi selama
5 menit pada suhu ruang, selanjutnya ditambah dengan 200 µl kloroform, dibolakbalik selama 30 detik. Setelah diinkubasi 3 menit pada suhu ruang lalu campuran
disentrifugasi dengan kecepatan 9000 rpm (Joun BR4i) selama 15 menit pada
suhu 6 ºC. Supernatan dipindahkan pada tabung baru dan ditambahkan 500 µl
20
isopropil alkohol dan diinkubasi 10 menit pada suhu ruang kemudian
disentrifugasi pada 9000 rpm (Jouan BR4i) selama 15 menit pada suhu 6 ºC.
Supernatan dari hasil sentrifugasi dibuang dan endapan dicuci dengan
penambahan 500 µl etanol-DEPC 75 % (v/v) dan diikuti dengan sentrifugasi pada
5700 rpm (Jouan BR4i) selama 5 menit pada suhu 6 ºC. Etanol 75 % (v/v)
dibuang, endapan dikeringkan dengan menggunakan vacuum dryer selama 5
menit. Setelah kering endapan disuspensi dalam 20 µl ddH2O DEPC 0,1 % (v/v).
Kuantifikasi dilakukan dengan melarutkan 1 µl larutan RNA total dalam 700 µl
ddH2O-DEPC selanjutnya dibaca dengan menggunakan spektrofotometer UV-VIS
(Cecil CE 2020), absorbansi diukur pada panjang gelombang 260 nm dan 280 nm
(Sambrook et al. 1989). Keutuhan RNA total dianalisis secara kualitatif
menggunakan metode elektroforesis, dengan memigrasikan RNA pada gel agarose
di dalam buffer MOPS 1 % (v/v) (4,2 g/l 3-Morpholinopropanesulfonic acid
(C7H15NO4), 0,41 g/l Na-asetat, 0,37 g/l Na2EDTA.H2O) pada voltase konstan
100 volt selama 35 menit. Visualisasi RNA dilakukan di atas lampu UV
transluminator GelDoc (Labquip).
Sintesis cDNA total
RNA total yang diperoleh digunakan sebagai cetakan untuk sintesis cDNA
total dengan menggunakan metode RT (Reverse Transcription/transkripsi balik)
yang sudah dipublikasi (Suharsono et al. 2002). RNA total sebanyak 500 ng dari
masing-masing perlakuan di campur dengan 4 µl 5 X buffer reaksi, 20 µl primer
oligo dT, 1 unit enzim reverse transcriptase (Invitrogen), 2 µl dTT (0,1M), 2 µl
dNTPmix 2 mM dan di tambahkan ddH2O DEPC 0,1 % steril sampai volume
akhir 20 µl. Reaksi transkripsi balik dilakukan pada suhu 30 ºC 10 menit, diikuti
oleh suhu 42 ºC 60 menit, dan suhu 95 ºC 5 menit.
Evaluasi terhadap keberhasilan sintesis cDNA total dilakukan dengan
amplifikasi cDNA dari gen penyandi Ubiquitin melalui PCR dengan cDNA total
sebagai cetakan. PCR dilakukan dengan mencampur 0,5 µl hasil RT dengan 1 µl
buffer Taq 10x, dNTPmix 2 mM 1 µl, DMSO 0,4 ul, 0,2 µl DNA Taq
Polymerase, 0,5 µl primer Ubiquitin forward (20 pmol), 0,5 µl primer Ubiquitin
reverse (20 pmol), dan ditambahkan ddH2O sampai volume akhir 20 µl. Kondisi
21
PCR untuk Ubiquitin adalah: pra-PCR pada suhu 95 ºC selama 5 menit, denaturasi
pada suhu 94 ºC selama 30 detik, penempelan primer pada suhu 58 ºC selama 30
menit, pemanjangan DNA pada suhu 72 ºC selama 2 menit, siklus diulang
sebanyak 35 kali, pasca PCR pada suhu 72 ºC selama 5 menit dan proses
pendinginan pada suhu 15 ºC selama 10 menit. Hasil PCR dimigrasikan di gel
agarose 1,5 % di dalam larutan penyangga TAE 1x (4,84 gr tris base, 1,142 ml
asam asetat glasial, 2 ml 0,5M EDTA pH 8).
Analisis ekspresi gen PR1 dan gen PBZ1
Analisis ekspresi dilakukan dengan melakukan amplifikasi gen spesifik PR1
dan PBZ1 dengan PCR menggunakan cDNA yang diperoleh dari hasil RT sebagai
cetakan. Analisis ekspresi gen PR1 dan PBZ1 pada perlakuan 0, 1, 3 dan 7 hari
setelah infeksi dilakukan dengan membandingkan hasil amplifikasi cDNAnya.
Kondisi PCR untuk amplifikasi cDNA dari gen PBZ1 dan PR1 adalah sama
dengan PCR pada Ubiquitin kecuali pada tahap penempelan primer. Pada tahap
penempelan amplifikasi primer PR1 menggunakan suhu 55 °C selama 30 detik
dan amplifikasi primer PBZ1 mengunakan suhu 56 °C selama 30 detik.
HASIL DAN PEMBAHASAN
Penapisan ketahanan beberapa varietas tanaman padi terhadap P.grisea
Penelitian ini menggunakan dua isolat 001 yang berasal dari koleksi yang
berbeda-beda, yaitu isolat 001B asal koleksi BB-Biogen dan isolat 001M asal
koleksi Balai Penelitian Tanaman Padi Muara (Balitpa). Hal tersebut dilakukan
karena diduga terdapat perbedaan genetik kedua isolat tersebut. Hasil percobaan
menunjukkan bahwa masing-masing varietas memberikan respon ketahanan yang
berbeda terhadap kedua isolat tersebut (Tabel 4, Lampiran 1).
Tabel 4. Reaksi ketahanan beberapa varietas padi terhadap dua isolat P. grisea.
Varietas padi
Isolat P.grisea
001B
001M
Asahan
R
R
IR64
MR
MR
Cisadane
R
R
Cisanggang
S
MS
Kencana Bali
S
S
Keterangan : R = tahan, MR = moderat tahan, MS = moderat peka, S = peka
Pada penelitian selanjutnya hanya isolat 001M yang digunakan, karena hasil
isolat 001M mempunyai nilai skala yang lebih konsisten/seragam (3x ulangan)
terhadap kelima varietas berdasarkan skala penyakit IRRI 1996 (Lampiran 1).
Utami et al. (2000), Amir dan Nasution (2001) dan Utami (2005) menyatakan
bahwa isolat 001 adalah isolat yang selalu dijumpai pada setiap musim tanam
artinya isolat ini memiliki penyebaran yang luas. Oleh sebab itu isolat ini selalu
dipakai sebagai dasar dalam analisis rata-rata generasi serta mempunyai sebaran
frekuensi yang paling rendah virulensinya, dengan perbandingan tahan:peka =
3:1. Terjadinya perbedaan respon ketahanan tanaman terhadap isolat 001B dan
001M diduga karena adanya perbedaan lokasi asal isolat, faktor lingkungan
sekitarnya dan waktu tanam (Mogi et al. 1991). Hal ini sesuai dengan penelitian
Chen et al. (1995), yang menyatakan bahwa perbedaan lokasi asal isolat blas
mengakibatkan perbedaan besar dalam sidik jari DNA genom isolat blas dengan
pelacak MGR 586.
23
Dari kelima varietas yang telah berhasil diinfeksi (Gambar 6), Cisadane dan
Kencana Bali dipilih sebagai varietas tahan dan peka terhadap P. grisea untuk
analisis ekspresi gen. Respon kedua varietas tersebut konsisten pada tiga kali
ulangan yang dilakukan di rumah kaca. Hasil tersebut didukung pula oleh Santoso
(2005) yang membuktikan bahwa varietas Cisadane merupakan varietas tahan
blas, varietas Kencana Bali merupakan varietas yang peka dengan intensitas
serangan tertinggi di Indonesia (Mogi et al. 1991; Nugraha 2005).
Varietas Cisadane tidak memperlihatkan gejala blas sampai akhir
pengamatan (sepuluh hari setelah infeksi) (Gambar 5). Hal ini diduga karena
varietas ini memiliki kemampuan untuk membatasi penetrasi apresorium blas dan
mematikan patogen tersebut. Menurut Takahashi (1997) dan Kim et al. (2002)
adanya deposisi senyawa silikat di dalam jaringan epidermis daun varietas tahan
dapat melindungi invasi hifa cendawan secara mekanis. Selain itu varietas padi
yang tahan juga cenderung menghambat pembentukan spora blas dengan
memproduksi fitoaleksin tertentu sebagai akibat interaksi antar patogen dan
tanaman padi (Dillon et al. 1997; Rodrigues et al. 2004).
(a)
(b)
(c)
(d)
(e)
Gambar 5. Serangan blas daun padi pada hari ke sepuluh setelah infeksi. Varietas
tahan: Asahan (a), Cisadane (b). Varietas moderat tahan : IR64 (c)
Varietas peka: Cisanggang (d), Kencana Bali (e). Bar = 1mm.
Munculnya gejala penyakit blas pada daun padi dipengaruhi oleh tiga faktor
yaitu daya infeksi patogen, tingkat ketahanan tanaman dan lingkungan.
Lingkungan yang berpengaruh terhadap intensitas serangan blas adalah suhu dan
kelembaban. Sporulasi optimum berlangsung pada suhu 28 ºC, dengan
kelembaban relatif 95 % dan kondisi gelap selama 15 jam (Ou 1985).
Menurut Ou (1985) kerentanan daun padi terhadap infeksi patogen
berhubungan dengan kandungan silikat pada dinding sel epidermis daun padi.
24
Sel-sel daun muda mempunyai kandungan silikat yang masih rendah sehingga
apresorium dapat menembus dinding sel epidermis daun padi muda.
Kerapatan spora yang digunakan pada penelitian ini sama dengan kerapatan
spora pada penelitian Santosa (2005) dan Bakhtiar (2007) yaitu 3 x 10 5 spora/ml
larutan. Hanya spora yang dapat membentuk apresorium pada media
haemacytometer yang bisa melakukan penetrasi pada permukaan jaringan
tanaman dan menimbulkan gejala penyakit blas (Gambar 6).
Spora
apresorium
20 µm
(a)
20 µm
20 µm
(b)
(c)
20 µm
(d)
Gambar 6. Perkembangan spora pada media kaca (a) 1jam setelah infeksi, (b) 24
jam setelah infeksi, (c) 48 jam setelah infeksi, (d) 72 jam setelah
infeksi.
Menurut Dean et al. (1994) bahwa tahap awal pengenalan patogen blas
dengan tanaman padi ditandai oleh sinyal lingkungan seperti suhu dan
kelembaban yang mendukung terjadinya perkecambahan konidia dengan
membentuk apresorium sebagai alat infeksi. Bila ada sinyal infeksi maka pada
apresorium akan muncul enzim-enzim tertentu untuk membantu penetrasi seperti
gen ALBI, RSYI, BUFI dan CUTI. Apabila tidak ada sinyal infeksi berati tidak ada
pembentukan apresorium sehingga yang berperan adalah sinyal pertumbuhan
vegetatif seperti adanya nutrien gula dalam media tumbuh dari blas.
Protein dalam sinyal infeksi sekaligus berperan sebagai sinyal pengenal
elisator patogen bagi tanaman. Sinyal elisitor patogen akan dikenal oleh tanaman
melalui elisitor binding reseptor yaitu gen R yang terdapat pada permukaan
jaringan tanaman yaitu Pi-b dan Pi-ta (Ito dan Shibuya 2000).
Isolasi RNA Total
RNA total telah berhasil diisolasi dari daun tanaman padi baik kontrol (air +
tween 0,25 % (v/v)) maupun hasil infeksi (isolat P.grisea 001M + tween 0,25 %
25
(v/v)). Kuantifikasi RNA total dengan spektrofotometer pada panjang gelombang
260 nm menunjukkan bahwa rendemen RNA berkisar antara 3,02 µg sampai 8,37
µg dari tiap gram daun tanaman padi (Lampiran 2).
Pengujian kemurnian RNA total dari kontaminan protein dilakukan dengan
membandingkan nilai OD (Optical Density) dengan panjang gelombang 260 dan
panjang gelombang 280. Rasio OD260/OD280 yang diperoleh berkisar antara 1,50
sampai 1,73. Keadaan itu menunjukkan terdapat variasi kemurnian RNA dari
varietas padi yang diuji dengan rata-rata OD sebesar 1,57.
Hasil analisis integritas RNA total dengan elektroforesis gel agarosa
menggunakan formaldehid, menunjukkan bahwa RNA total memiliki 2 pita RNA
ribosomal (28S dan 18S) yang dominan, pada daun padi kontrol maupun yang
telah diinfeksi. Selain kedua pita tersebut, RNA total dari daun juga mengandung
beberapa pita rRNA yang merupakan rRNA mitokondria dan kloroplas. Integritas
mRNA, rRNA dan tRNA yang baik adalah yang tidak mengalami degadrasi, yaitu
ditandai dengan pita rRNA (28S dan 18S) yang masih bagus dan utuh (Gambar 7).
Infeksi
Kontrol
Cisadane
0H
1H
3H
Kencana Bali
7H
0H
1H
3H
Cisadane
7H
0H
1H
3H
Kencana Bali
7H
0H
1H
3H
7H
28S
18S
Gambar 7. RNA total dari daun tanaman padi kontrol dan yang telah diinfeksi
oleh isolat 001M (H=jumlah hari setelah infeksi).
Sintesis cDNA Total
Hasil RNA total yang telah diisolasi dengan reagen TRIzol kit digunakan
sebagai cetakan untuk sintesis cDNA melalui proses transkripsi balik (reverse
transcription). Primer yang digunakan dalam proses transkripsi balik pada
tahapan ini adalah primer oligo-dT, sehingga hanya mRNA yang dapat disintesis
menjadi cDNA. Diketahui bahwa hanya mRNA yang mengandung poly(A) pada
ujung 3’, sedangkan rRNA dan tRNA tidak mempunyai poly(A).
26
cDNA yang didapat dari proses transkripsi balik selanjutnya dipakai sebagai
cetakan untuk reaksi PCR dengan primer Ubiquitin. Primer ini digunakan sebagai
kontrol internal untuk melihat keberhasilan sintesis cDNA dan verifikasi kualitas
RNA total. Ubiquitin (Ubq) merupakan protein yang terdapat di semua sel
eukariot. PCR dengan menggunakan primer dari gen Ubq dan dengan cetakan
cDNA, menghasilkan pita DNA yang berukuran sekitar 265 pb (Gambar 8).
Kontrol
Cisadane
0H
1H
3H
Infeksi
Kencana Bali
7H
0H
1H
3H
Cisadane
7H
0H
1H
3H
Kencana Bali
7H
0H
1H
3H
7H
265 bp (Ubq)
Gambar 8. Hasil PCR Ubiquitin yang berasal dari cetakan cDNA (H=jumlah hari
setelah infeksi).
Hasil ini menunjukkan bahwa daerah yang diamplifikasi adalah cDNA,
bukan DNA dari gen Ubq. Teramplifikasinya cDNA dengan primer Ubq dengan
ukuran 265 pb menunjukkan bahwa sintesis cDNA total melalui proses transkripsi
balik telah berjalan dengan baik. Selain itu, juga membuktikan bahwa RNA total
yang telah diisolasi melalui metode TRIzol mempunyai kualitas yang baik,
sehingga dapat digunakan untuk mensintesis cDNA dan murni dari gangguan
DNA. Jika RNA mengandung DNA maka akan dihasilkan pita yang berukuran
lebih besar dari 265 bp. Kondisi ini dapat terjadi apabila RNA total yang
diperoleh terkontaminasi oleh DNA. RNA yang telah terkontaminasi dengan
DNA tidak dapat dipakai untuk analisis gen ekspresi.
Analisis Ekspresi gen PR1 dan PBZ1
Ekspresi gen PR1 dan gen PBZ1 pada daun tanaman kontrol baik pada
varietas tahan (Cisadane) maupun peka (Kencana Bali), tidak terinduksi oleh
serangan patogen. Hal tersebut dibuktikan dengan tidak adanya pita pada setiap
perlakuan pada tanaman kontrol (Gambar 9). PBZ1 dan PR1 adalah suatu gen PR
pada padi yang diinduksi oleh infeksi patogen cendawan, diantaranya adalah
P. grisea (Takahashi et al. 1999; Suharsono et al. 2002; Tanabe et al. 2006).
27
Pada varietas Cisadane ekspresi gen PBZ1 muncul pada hari ke-1 setelah
infeksi dengan ukuran 563 pb. Pada varietas Kencana Bali, gen tersebut baru
terekspresi pada hari ke-7 setelah infeksi dengan ukuran 563 pb dan ± 900 pb
(Gambar 9). Perbedaan amplifikasi gen PBZ1 pada Cisadane dan Kencana Bali
disebabkan oleh adanya perbedaan genotipe, gen Resisten, karakter dan asal
persilangan dari kedua varietas tersebut (Lesmana et al. 2004).
Kontrol
Cisadane
0H
1H
3H
Infeksi
Kencana Bali
7H
0H
1H
3H
Cisadane
7H
0H
1H
3H
Kencana Bali
7H
0H
1H
3H
7H
265 bp (Ubq)
523 bp (PR1)
900 bp
563 bp (PBZ1)
Gambar 9. Ekspresi PR1 dan PBZ1 menggunakan cDNA total dari daun padi
kontrol dan yang telah diinfeksi sebagai cetakan (H=jumlah hari
setelah infeksi).
Menurut Nugraha (2005) berdasarkan marka mikrosatelit RM 224 terdapat
perbedaan genotipe antara Cisadane dan Kencana Bali. Pada tingkat kesamaan
80 % varietas Kencana Bali termasuk ke dalam kelompok utama I (175pb)
sedangkan varietas Cisadane termasuk ke dalam kelompok utama II (150pb).
Perbedaan jumlah gen Resisten menunjukkan bahwa varietas Cisadane
mempunyai satu gen resisten yaitu P1-2 (t) sedangkan varietas Kencana Bali
mempunyai dua gen resisten yaitu Pi-2 (t) dan Pi-10 (Mogi et al. 1991).
Pada varietas Kencana Bali (peka), terjadi penundaan ekspresi selama
enam hari, sedangkan pada varietas Cisadane (tahan) ekspresi terjadi lebih awal
(1 hari), karena memiliki kemampuan untuk membatasi penetrasi apresorium blas
dan mematikan patogen tersebut serta membentuk hipersensitif (HR) (Gambar 9).
Varietas tahan membentuk ekspresi pada hari pertama karena terjadinya interaksi
yang incompatible (no disease) antar gen Avr dari patogen dan gen R dari
28
tanaman, sehingga terjadi mekanisme pertahanan (Gilchrist 1998). Hal ini sesuai
dengan penelitian Koga (1994) yang mengatakan bahwa sel daun varietas tahan
yang telah terinfeksi dengan patogen akan membentuk respon HR, 17 - 31 jam
setelah infeksi.
Menurut Suharsono et al. (2002) keterlambatan 1 hari dalam sistem
pertahanan sudah bisa membedakan antar varietas yang tahan dan yang peka.
Mogi et al. (1991) mengatakan bahwa salah satu sifat ketahanan ideal yang harus
dimiliki oleh varietas tahan adalah hanya memiliki satu gen tunggal, dalam hal ini
diketahui bahwa varietas Cisadane memiliki gen tunggal yaitu P1-2(t).
Ekspresi gen PR1 tidak terinduksi pada kedua varietas baik pada tanaman
yang diinfeksikan isolat 001M maupun pada tanaman kontrol (Gambar 9). Hal ini
menunjukkan bahwa gen PR1 tidak terlibat dalam sistem pertahanan tanaman padi
indica terhadap serangan patogen P.grisea. Namun, hasil penelitian Suharsono et
al. (2002), pada tanaman padi japonica varietas Kinmaze, gen PR1 telah
terekspresi pada hari ke dua dan ke tiga setelah infeksi. Perbedaan ekspresi
disebabkan oleh adanya perbedaan genotipe sel inang (isolat), perbedaan varietas
padi yang digunakan serta resistensi tanaman tersebut.
Gee et al. (2001) dalam studinya tentang karakteristik gen PR10
mendapatkan bahwa dalam genom padi terdapat 3 gen yang memiliki kesamaan
dengan gen PR10, yaitu gen RPR10a, RPR10b, RPR10c tetapi ketiganya memiliki
ekspresi yang berbeda. Ekspresi gen RPR10a dan RPR10b terinduksi karena
adanya infeksi cendawan Magnaporthe griesa, sedangkan gen RPR10c tidak
terinduksi oleh M. grisea.
Peningkatan virulensi dari patogen blas dapat mengaktifkan kelompok gen
yang mengkode PR protein gen famili (PR1-PR14) yang salah satunya termasuk
kelompok PR1 dan PBZ1 (PR10) pada tanaman padi sebagai respon dari resisten
pertahanannya. Tingkat patogenesis ditentukan oleh pertahanan inang dalam
mengaktifkan perangkat pertahanan, makin cepat tanaman mengaktifkan
perangkat ketahanannya makin minimal tingkat patogenesisnya (Buchanam et al.
2000; Silue et al. 1992).
SIMPULAN DAN SARAN
Simpulan
Pyricularia grisea isolat 001M mempunyai nilai skala yang lebih
seragam/konsisten terhadap kelima varietas berdasarkan skala penyakit IRRI 1996
dibandingkan dengan Pyricularia grisea isolat 001B.
Hasil penapisan dengan isolat 001M diperoleh 2 varietas tahan (R) yaitu
Cisadane dan Asahan, 1 varietas moderat tahan (MR) yaitu IR64, 2 varietas peka
(S) yaitu Cisanggang dan Kencana Bali. Untuk analisis ekspresi hanya digunakan
1 varietas tahan (R) yaitu Cisadane dan 1 varietas peka (S) yaitu Kencana Bali.
Ekspresi gen PR1 tidak terinduksi sampai 7 hari setelah infeksi pada kedua
varietas. Tidak adanya ekspresi gen PR1 membuktikan bahwa gen ini tidak
terlibat dalam sistem pertahanan tanaman padi terhadap P. grisea isolat 001M.
Ekspresi gen PBZ1 terinduksi oleh P. grisea isolat 001M. Varietas Cisadane
terekspresi pada hari pertama setelah infeksi, varietas Kencana Bali terekspresi
pada hari ke tujuh setelah infeksi
Hasil amplifikasi gen PBZ1 pada Cisadane berbeda dengan Kencana Bali
karena adanya perbedaan genotipe, gen resisten dan karakter serta asal persilangan
dari kedua varietas tersebut.
Saran
Untuk mengetahui peranan PBZ1 dalam ketahanan tanaman padi terhadap
cendawan Pyricularia grisea 001M perlu penelitian lebih lanjut dengan cara
menumbuhkan cendawan yang terdapat pada daun yang terinfeksi.
DAFTAR PUSTAKA
Agrios NG. 1998. Plant Pathology. Florida: Academic Press. Hlm.115-142.
Agrawal GK, Rakwal R, Jwa NS. 2001. Differential Induction of Three
Pathogenesis Related Genes, PR10, PR1b and PR5 by Ethylene Generator
Ethephon under Light and Dark in Rice (Oryza sativa L.) Seedlings. Plant
Physiol 158: 133-137.
Ahn IP, Kim S, Lee YH. 2005. Vitamin B1 Functions as An Activator of Plant
Disease Resistance. lant Physiol 138: 1505-1515.
Ahn SW, Amir M. 1986. Rice Blast Management under Upland Condition. Di
dalam: Progress in Upland Rice Research. Phillipines: IRRI. Hlm. 363-374.
Amir M, Nasution A. 2001. Identification of Major Genes for Blast Resistance.
Current Status and Future Direction. Bogor: Central Research Institute for
Food Crops, Agency for Agricultur Research and Development.
Amir M. 2002. Strategi Penyelamatan Padi Gogo dari Ancaman Penyakit Blas.
Di dalam: Hermanto, Kasim H, Adil WH, editor. Risalah Seminar 20002001 Pusat Penelitian dan Pengembangan Tanaman Pangan. Bogor: Pusat
Penelitian dan Pengembangan Tanaman Pangan. Hlm 68-76.
Amril B. 1992. Pengendalian Penyakit Blas Padi Gogo. Di Dalam: Risalah
Seminar Hasil-hasil Penelitian Balittan Sukarami. Vol. 1. Sukarami: Badan
Penelitian dan Pengembangan Pertanian. Balai Penelitian Tanaman Pangan.
Hlm. 189-197.
Babujee L, Gnanamanickam SS. 2000. Molecular Tools for Characterization of
Rice Blast Pathogen (Magnoporthe grisea) Population and Molecular
Marker-Assisted Breeding for Disease Resistance. Current Sci 78: 248-257.
Bakhtiar. 2007. Penapisan Galur Padi Gogo (Oryza Sativa L.) Hasil Kultur Antera
Untuk Ketenggangan Aluminium dan Ketahanan Terhadap Penyakit Blas
[Disertasi] Bogor: Sekolah Pascasarjana Institut Pertanian Bogor
Bonman JM, de Dios TIV, Bandong JM, Lee EJ. 1987. Pathogenic Variability of
Monoconidial Isolates of Pyricularia Oryzae in Korea and in Philippines.
Plant Disease 71 : 127-130.
Bonman JM, Estrada BA, Bandong JM. 1989. Leaf and Neck Blast Resistance in
Tropical Lowland Rice Cultivars. Plant Disease 73: 388-390.
Bryan GT et al. 2000. A Single Amino Acid Difference Distinguish Resistant and
Susceptible Alleles of The Rice Blas Resistance Gene Pi-ta. Plant Cell
12(11): 2033-2046.
31
Buchanam BB, Gruissem W, Jones RL. 2000. Biochemistry and Molecular
Biology of Plants. Courier Companies Inc. Hlm. 1115-1144.
Bussaban B et al. 2003. Three New Species of Pyricularia are Isolated as
Zingiberaceous Endophytes from Thailand. Mycologia 95(3): 519-524.
Chen D. 1993. Population Structure of Pyricularia Grisea (Cooke) Sacc. in Two
Screening Site and Quantitative Characterization of Major and Minor
Resistance Genes. A thesis Doctor of Phylosophy. University of the
Phillippines at Los Banos. hlm. 161.
Chen D, Zeigler RS, Leung H, Nelson RJ. 1995. Population Structure of
Pyricularia Grisea at Two Screening Site in The Philippines. Phytopat 85:
1011-1020.
Correa-Victoria FJ, Zeigler RS. 1995. Stability of partial and complete resintance
in rice to Pyricularia grisea under rainfed upland conditions in Eastern
Colombia. Phytopat 85: 1870-1878.
Dean RA, YH Lee, TK Mitchell, DS Whitehead. 1994. Signaling System and
Gene Expression Regulating Appressoium Formation in Magnaporthe
grisea. Di dalam: Rice Blast Disease. Filipina: CAB. International. IRRI. 2:
23-26.
Departemen Pertanian. 2004. Prakiraan Serangan Penyakit Blas pada Komoditi
Padi. [terhubung berkala] www.litbang.deptan.go.id.
Departemen Pertanian. 2005. Masalah Lapang, Hama, Penyakit, Hara pada Padi.
Pusat Penelitian dan Pengembangan Tanaman. hlm. 42-43.
Departemen Pertanian. 2007. Statistik Pertanian 2006. Jakarta: Pusat Data dan
Informasi Pertanian, Departemen Pertanian RI.
Dillon VM, Overton J, Grayer RJ, Harborne JB. 1997. Differences in Phytoalexin
Response among Rice Cultivars of Different Resistance to Blast. Phytochem
44: 599-603.
Finckh MR. 1994. Gene Deployment for The Management of Rice Disease and
Insect Pest. Di dalam: Population Genetic and Rice Disease Management.
Bogor: Workshop CRIFC. Indonesia. 5-8 July.
Fucuta Y et al. 2002. Development Of Differential Varieties for Blast Resistance
In IRRI-Japan Collaborative Research Project. 3rd International Rice Blast
Conference. Tsukuba-Japan.
Gee MJD, Hamer JE, Hodges TK. 2001. Characterization of a PR-10
Pathogenesis-Related Gene Family Induced in Rice during Infection with
M. grisea. Molec Plant-Microbe Interac 14(7): 877-886.
32
Gilchrist JS. 1998. The Pathways Connecting G Protein-Coupled Receptors to
The Nucleus through Divergent Mitogen-Activated Protein Kinase Cascade.
J Biol Chem 273: 1839-1842.
Hammond-Kosack KE, Jones JGD. 1997. Plant Disease Resistance Genes. Annu.
Rev. Plant. Physiol 48: 575-607.
Heisser I, Durner J, Langerbartels C. 2005. Interactions Between Host Plants and
Fungal and Bacterial Pathogens. Di dalam : Hock B and Elstner EF, editor.
Plant Toxicology. Marcel Dekker, New York. hlm. 555-595.
Herdt RW. 1991. Research Priorities for Rice Biotechnology. Di dalam : Khush
GS, Toennissen GH, editor. Rice Biotechnology. Alden Press Ltd., London.
hlm. 35-37.
International Rice Research Institute (IRRI). 2003. Rice Blast. Philippines.
International Rice Research Institute (IRRI). 1996. Standar Evaluation System for
Rice. 4th. IRRI. Manila. hlm. 52.
Ito Y, Shibuya N. 2000. Receptors for the Microbial Elicitors of Plants Defense
Responses. Di dalam : Stacey G. Keen NT. Editors. Plant Microbe
Interaction. APS Press.
Iwata M. 2001. Probenazole-A Plant Defence Activator. The Royal Society of
Chemistry. hlm.28-31.
Izawa T et al. 2002. Phytochrome Mediates the External Light Signal to Repress
FT Orthologs in Photoperiodic Flowering of Rice. Genes & Dev. 16(15):
2006-2020.
Jones DA, Thomas CM, Hammond-Kosack KE. 1994. Isolation of the Tomato Cf9 Gene for Resistance to Clasposporium fulvum by Transposon Tagging.
Science 266: 789-793.
Kachroo P, Leong SA, Chattoo BB. 1994. Pot2, an Inverted Repeat Transposon
from the Rice Blast Fungus Magnaporthe grisea. Mol. Gene. Genet 245:
339-348.
Kawasaki T et al. 1999. The Small GTP-Binding Protein Rac is a Regulator of
Cell Death in Plants. Proc. Natl. Acad. Sci. USA 96: 10922-10926.
Kim SG, Kim KW, Park EW, Choi D. 2002. Silicon-Induced Cell Wall
Fortification of Rice Leaves: A Possible Celluler Mechanism of Enhanced
Host Resistance to Blast. Phytopath 92: 1095-1103.
Kiyosawa S. 1981. Gene Analysis for Blast Resistance. Oryza 18: 196-203.
33
Kobayashi T, Kanada E, Ishiguro K, Torigoe Y. 2001. Detection of Panicle Blast
with Multispectral Radiometer and the Potential of Using Airborne
Multispectral Scanners. Phytopath 91: 316-323.
Koga H. 2001. Cytological Aspects of Infection by the Rice Blast Fungus
Pyricularia oryzae. Di dalam : Screenvasaprasad S, Johnson R, editor.
Major Fungal Disease of Rice Recent Advences. Kluwer Academic
Publishes. hlm. 87-110.
Kustianto B, Amir M, Suwarno. 1993. Studi Genetika Sifat Tahan Blas pada
beberapa Varietas Padi Gogo. Penelitian Pertanian 13 : 21-24.
Lesmana OS, Toha HM, Las I, Suprihatno B. 2004. Deskripsi Varietas Unggul
Baru Padi. Badan Penelitian dan Pengembangan Pertanian. Balai Penelitian
Padi. Sukamandi. hlm 74.
Leung H, Shi Z. 1994. Genetic Regulation of Sporulation in the Rice Blast
Fungus. Di dalam : Zeigler RS, Leong SA, Teng PS, editor. Rice Blast
Disease. Wallingford (UK) : CAB International-IRRI. Manila, Philippines.
Lebrun MH et al. 1991. Biology and Genetic of Pyricularia oryzae and P. Grisea
Population Current Situation and Development of RFLP Markers. In: Rice
Genetics 2 Proccedings of the second International Rice Genetics
Symposium IRRI. Los Banos, Laguna. The Philippines hlm. 487-497.
Midoh N, Iwata M. 1996. Cloning and Characterization of a Probenazole
Inducible Gene for an Intraseluler Pathogenesis Related Protein in Rice.
Plant Cell Physiol. 37: 9-18.
McCouch SR, Nelson RJ, Tohme J, Zeigler RS. 1994. Mapping of Blast
Resistance Genes in Rice. Di dalam: Zeigler RS. Leong SA, Teng PS.
Editors. Philippines: CAB. International. IRRI.
Mogi et al. 1991. Establishment Series for Pathogenic Race Identification of Rice
Blast Fungus and the Distribution of Race Based on the New Differential
Indonesia. Rice Disease Study Group Karawang. Jatisari. Indonesia.
Nakashita H et al. 2001. Characterization of PBZ1, a Probenazole-Inducible
Gene, in Suspension-Cultured Rice Cells. Biosci Biotechnol Biochem.
65(1): 205-208.
Naqvi NI, Chattoo BB. 1996. Development of a Sequence Characterized
Amplified Region (SCAR) Based Indirect Selection Method for a Dominant
Blas Resistance Gene in Rice. Genome 39: 26-30.
Nugraha MFI. 2005. Identifikasi Genotipe Padi yang memiliki Gen-Gen
Ketahanan terhadap Penyakit Blas. [Tesis] Sekolah Pascasarjana Institut
Pertanian Bogor.
34
Orbach MJ et al. 2000. A Telomeric Avirulence Gene Determines Efficacy for the
Rice Blast Resistance Gene Pi-ta. Plant Cell 12: 2019-2032.
Ou SH. 1985. Rice Disease. 2nd ed. Commonw. Mycol Inst. 2nd ed. Kew. Surrey.
hlm. 380.
Ramli M. 2000. Ketahanan dan Dinamika Ketahanan selama Pertumbuhan
beberapa Genotipe Padi terhadap Blas Daun dan Blas Leher Malai. [Tesis]
Sekolah Pascasarjana Institut Pertanian Bogor.
Reflinur. 2005. Keragaman Genetik Cendawan Pyricularia grisea berdasarkan
Primer Spesifik Gen Virulensi dan Interaksinya terhadap Gen Ketahanan
Padi. [Tesis] Bogor. Sekolah Pascasarjana Institut Pertanian Bogor.
Rodrigues FA, McNally DJ, Datnoff LE, Jones JB. 2004. Silicon Enhances the
Accumulation of Diterpenoid Phytoalexins in Rice: A Potential Mechanism
for Blast Resistance. Phytopath 94: 177-183.
Rossman AY, Howard RJ, Valent B, Chumley F. 1990. Pyricularia grisea, the
Correct Name for the Rice Blast Disease Fungus. Mycologia 82 : 529-512.
Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular Cloning a Laboratory
Manual (2nd.ed) Cold Sring Harbor Lab Press. USA. P.1567.
Santoso. 2005. Analisis Ketahanan 28 Genotipe Padi terhadap Penyakit Blas Daun
dan Hubungannya dengan Keberadaan Gen Pi-b dan Pi-ta. [Tesis] Bogor.
Sekolah Pascasarjana Institut Pertanian Bogor.
Scardaci SC et al. 1997. Rice Blast : A New Disease in California. Agronomy
Fact Sheet Series 1997-2. Departement of Agronomy and Range Science,
University of California, Davis.
Schweizer P et al. 1997. Gene Expression Pattern and Levels of Jasmonic Acid in
Rice Treated with the Resistance Inducer 2,6-dichloroisonicotinic Acid.
Plant Physiol 105:659-665.
Selitrennikoff CP. 2001. Antifungal Protein. Appl Environ Microbiol
2883-2894.
67(7):
Shimamoto K, Takahashi A, Kawasaki T. 2001. Molecular Signaling in Disease
Resistance of Rice. Di dalam: Rice Genetics IV. IRRI. Manila. Philippines.
hal. 323-333.
Shimono M et al. 2000. Analysis of Gene Expression in Rice Plants Treated with
an Inducer of Disease Resistance, Using DNA Microarray. Ann Phytopath
Soc Japan 66: 115-116 (Japanese Abstract).
35
Shimono M et al. 2007. Rice WRKY45 Plays a Crucial Role in Benzothiadiazole
Inducible Blast Resistance. Plant Cell 19: 2064-2076.
Silue D, Notteghem JL, Tharreau D. 1992. Evidence for a gene-for-gene
Relationship in the Oryza sativa Magnopoethe grisea Pathosystem.
Phytopath 82: 577-580.
Staskawicz BJ et al. 1995. Molecular Genetics of Plant Disease Resistance.
Science 268: 661-667.
Suharsono U et al. 2002. The Heterotrimeric G Protein α Subunit Acts Upstream
of the Small GTPase Rac in Disease Resistance of Rice. Proc Natl Acad Sci
99(20): 13307-13312.
Takahashi A et al. 1999. Lesion Mimic Mutants of Rice with Alterations in Early
Signaling Events of Defense. Plant Journal 17: 535-545.
Takahashi E. 1997. Uptake Mode and Physiological Functions of Silica. Di
dalam: Tanane M, Yuzo M, Fumio K, Hikoyuki Y. Editor. Science of rice
plant. Physiology Volume 2. Tokyo: Food and Agriculture Policy Research
Center. hlm:420-433.
Tanabe et al. 2006. Induction of Resistance Againts Rice Blast Fungus in Rice
Plants Treated with a Potent Elicitor, N-Acetylchitooligosaccharide. Biosci.
Biotechnol. Biochem. 70(7): 1599-1605.
Tenjo FA, Hamer JE. 2002. Pathogenic Development in Magnaporthe grisea. Di
dalam : Goethe JW, editor. Molecular Biology of Fungal Development.
Universitas Frankfurt, Germany. hlm. 399-418.
Toriyama K, Ezuka A, Asaga K, Yokoo M. 1996. A Method for Estimating True
Resistance Genes to Blast in Rice Varieties. IRRI. Manila. Phillippines:
Rice Genetic 2: 323-333.
Utami DW, Amir M, Moeljopawiro S. 2000. Analisis RFLP Kelompok Ras dan
Haplotipe Isolat Blast dengan DNA pelacak MGR 586. J. Biotek. Pert.
5(1): 28-33.
Utami DW et al. 2005. Analisis Lokus Kuantitatif Sifat Ketahanan Penyakit Blas
pada Populasi Antarspesies IR64 dan Oryza rufipogon. J.Biotek Pert. 10(1):
7-14.
Van Loon LC, Pierpoint WS, Bolkert, Conjero V. 1994. Recommendation for
Warning Plant Pathogenesis Related Proteins. Plant Mol Biol 12: 245-265.
Van Loon LC, Van Strein EA. 1999. The Families of Pathogenesis-Related
Protein, their Activities and Comparative Analysis of PR1 Type Proteins.
Physiol. Mol. Biol 12: 245-264.
36
Voet, Donald JGV. 1995. Biochemistry 2nd ed. John Wilely & Sons. New York.
Wang Z, Mackill DJ, Bonman JM. 1989. Inheritance of Partial Resistance to Blast
in Indica Rice Cultivars. Crop Sci 29: 848-853.
Yu ZH, Mackill DJ, Bonman JM, Transkley SD. 1991. Tagging Genes for Blast
Resistance in Rice via Linkage to RFLP Markers. Theor. App. Genet 81:
471-476.
Zeigler RS. 1998. Recombination in Magnaporthe grisea. Annu. Rev. Phytopath
36: 249-275.
Zhao X, Mehrabi R, Xu JR. 2007. MAP Kinase Pathways and Fungal
Pathogenesis. Eukaryotic Cell 10: 1701-1714.
LAMPIRAN
38
Lampiran 1. Hasil penapisan isolat 001 Biogen dan 001 Muara menurut skala
penyakit IRRI 1996.
Varietas
Asahan
Ir64
Cisadane
Isolat 001 Biogen
Ulangan
Ulangan
Ulangan
Ulangan
Ulangan
Ulangan
1
2
3
1
2
3
1 Skala
1 Skala
Skala4
Skala 2
Skala 1 Skala
(MR)
(R)
(R)
(R)
(R)
(R)
Skala
5 Skala
3 Skala
3 Skala
4 Skala
4 Skala
(MR)
(R)
(R)
(MR)
(MR)
(MR)
Skala
1 Skala
4 Skala
0 Skala
0 Skala
0 Skala
(R)
(R)
(R)
(R)
6 Skala
8 Skala
6 Skala
6 Skala
(MS)
(MS)
(MS)
(R)
Cisanggang
Isolat 001 Muara
Skala
(S)
Kencana Bali Skala
(S)
(MR)
8 Skala
(MS)
(S)
9 Skala
8 Skala
8 Skala
9 Skala
9 Skala
(S)
(S)
(S)
(S)
(S)
Suhu
28 ºC
29 ºC
30 ºC
28 ºC
29 ºC
30 ººC
Kelembaban
95 %
94 %
93 %
95 %
94 %
93 %
Keterangan : R = Tahan, MR = Moerat tahan, MS= Moderat peka, S = Peka.
1
4
0
6
9
39
Lampiran 2. Hasil Kuantifikasi RNA Total
Varietas
Absorban pada
OD
Total
RNA
λ260
λ280
(λ260/λ280)
(µg/g daun padi)
Kencana Bali 0 hari (Kontrol)
0,241
0,155
1,55
6,75
Kencana Bali 1 hari
0,200
0,128
1,56
5,60
Kencana Bali 3 hari
0,206
0,126
1,61
5,77
Kencana Bali 7 hari
0,226
0,146
1,55
6,33
Cisadane 0 hari (Kontrol)
0,168
0,108
1,55
4,70
Cisadane 1 hari
0,299
0,192
1,56
8,37
Cisadane 3 hari
0,191
0,125
1,52
5,34
Cisadane 7 hari
0,108
0,072
1,50
3,02
Kencana Bali 0 hari (infeksi)
0,283
0,183
1,55
7,92
Kencana Bali 1 hari
0,293
0,182
1,61
8,20
Kencana Bali 3 hari
0,239
0,138
1,73
6,69
Kencana Bali 7 hari
0,237
0,144
1,65
6,64
Cisadane 0 hari (Infeksi)
0,252
0,166
1,52
7,05
Cisadane 1 hari
0,298
0,196
1,52
8,34
Cisadane 3 hari
0,235
0,150
1,57
6,58
Cisadane 7 hari
0,131
0,087
1,51
3,67
Download

ekspresi gen penyandi pathogenesis related protein